Incidental Mutation 'R6074:Tmem74'
ID482667
Institutional Source Beutler Lab
Gene Symbol Tmem74
Ensembl Gene ENSMUSG00000054409
Gene Nametransmembrane protein 74
Synonyms
MMRRC Submission 044235-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6074 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location43864646-43870036 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43866738 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 303 (V303A)
Ref Sequence ENSEMBL: ENSMUSP00000070748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067469]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067469
AA Change: V303A

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000070748
Gene: ENSMUSG00000054409
AA Change: V303A

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
Pfam:Neurensin 147 269 1.1e-12 PFAM
Meta Mutation Damage Score 0.0724 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.1%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amigo1 T A 3: 108,191,693 C189* probably null Het
Auts2 G T 5: 131,476,989 probably benign Het
Cadps2 C A 6: 23,626,671 W177L probably damaging Het
Camk2b G T 11: 5,989,635 P223Q probably damaging Het
Ccdc74a C A 16: 17,646,727 S9* probably null Het
Ccnt1 A C 15: 98,543,324 Y688D probably damaging Het
Cdhr1 T C 14: 37,079,643 N781S probably benign Het
Ceacam3 C T 7: 17,151,559 T29I probably benign Het
Cep170b T C 12: 112,744,155 S1473P probably damaging Het
Col19a1 T A 1: 24,526,483 T256S unknown Het
Eif2d T A 1: 131,166,342 D423E probably damaging Het
Fam13a A G 6: 58,989,738 probably null Het
Fam84a G A 12: 14,150,511 H72Y probably benign Het
Gaa G A 11: 119,284,186 R871H probably benign Het
Galnt12 T A 4: 47,112,405 V37D probably damaging Het
Glp2r A G 11: 67,746,814 S13P unknown Het
Gnptab C T 10: 88,433,078 L548F probably damaging Het
Heg1 C T 16: 33,727,203 P787S possibly damaging Het
Hivep2 T A 10: 14,131,741 M1361K probably benign Het
Hivep3 T C 4: 120,097,694 I1069T possibly damaging Het
Hspg2 A G 4: 137,540,735 D2121G probably benign Het
Htatip2 A G 7: 49,772,574 probably null Het
Ighv1-75 T C 12: 115,834,387 S4G probably benign Het
Ip6k1 A G 9: 108,024,109 probably benign Het
Kcna6 A G 6: 126,739,279 S216P probably benign Het
Kif21a T A 15: 90,980,892 T526S probably benign Het
Kng2 C T 16: 23,000,596 G230D probably benign Het
Lgi2 A T 5: 52,546,642 F216I probably benign Het
Lss T A 10: 76,543,859 N383K probably damaging Het
Mical1 T C 10: 41,486,065 M929T probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Nat8f4 A G 6: 85,901,187 V118A probably damaging Het
Olfr1198 A C 2: 88,746,222 L222R probably damaging Het
Olfr1416 G A 1: 92,479,775 T282M probably benign Het
Olfr16 T A 1: 172,957,378 N194K probably benign Het
Osbpl11 T A 16: 33,209,965 S188T probably benign Het
Pea15a C T 1: 172,199,185 R85H possibly damaging Het
Ppp1r13b A G 12: 111,832,402 I919T probably damaging Het
Rasgrf1 A G 9: 89,953,915 D232G probably benign Het
Rp1 A G 1: 4,345,379 S1837P probably benign Het
Samd5 T A 10: 9,674,590 Y125F possibly damaging Het
Skint5 T C 4: 113,805,200 T597A unknown Het
Slc25a12 A G 2: 71,276,454 F605L probably benign Het
Slc39a12 C T 2: 14,407,479 Q321* probably null Het
Slc6a19 T C 13: 73,689,763 S206G probably benign Het
Tacc2 T A 7: 130,625,435 H1283Q possibly damaging Het
Thumpd3 A G 6: 113,060,010 E290G possibly damaging Het
Timd2 C T 11: 46,687,172 G44D possibly damaging Het
Tpo A G 12: 30,078,187 V785A probably benign Het
Tpra1 T A 6: 88,911,937 I367N possibly damaging Het
Txnrd2 T C 16: 18,437,547 I95T probably damaging Het
Usp32 A G 11: 84,994,573 V1216A probably benign Het
Usp54 C A 14: 20,552,099 M1394I probably benign Het
Vmn2r13 A G 5: 109,174,301 F177L probably benign Het
Vmn2r82 T A 10: 79,396,543 V792E probably damaging Het
Wdfy4 C T 14: 33,083,639 probably null Het
Wnk2 A T 13: 49,051,399 C458S probably damaging Het
Xkr6 T G 14: 63,607,070 F181V possibly damaging Het
Zfp212 T A 6: 47,927,052 C149* probably null Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zfp661 A G 2: 127,577,873 S116P probably benign Het
Zfp770 A G 2: 114,196,389 Y400H possibly damaging Het
Other mutations in Tmem74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01873:Tmem74 APN 15 43867386 missense probably benign 0.05
IGL01985:Tmem74 APN 15 43867080 missense probably damaging 1.00
R1102:Tmem74 UTSW 15 43866790 missense probably benign 0.00
R1782:Tmem74 UTSW 15 43866952 missense probably damaging 1.00
R1851:Tmem74 UTSW 15 43867163 missense probably benign 0.29
R1852:Tmem74 UTSW 15 43867163 missense probably benign 0.29
R2352:Tmem74 UTSW 15 43867110 missense probably damaging 1.00
R3401:Tmem74 UTSW 15 43867021 missense probably damaging 1.00
R3402:Tmem74 UTSW 15 43867021 missense probably damaging 1.00
R3403:Tmem74 UTSW 15 43867021 missense probably damaging 1.00
R4095:Tmem74 UTSW 15 43867282 nonsense probably null
R4607:Tmem74 UTSW 15 43867158 missense probably damaging 0.98
R4608:Tmem74 UTSW 15 43867158 missense probably damaging 0.98
R5218:Tmem74 UTSW 15 43867244 missense possibly damaging 0.52
R5304:Tmem74 UTSW 15 43866821 nonsense probably null
R5375:Tmem74 UTSW 15 43867168 missense possibly damaging 0.77
R7264:Tmem74 UTSW 15 43867468 missense probably benign 0.00
R7485:Tmem74 UTSW 15 43867365 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCTGGCTATGGTTTCTTTTACAAC -3'
(R):5'- TGGATCCCAATACAGTGGCAG -3'

Posted On2017-07-14