Incidental Mutation 'R6075:Sntg1'
ID482676
Institutional Source Beutler Lab
Gene Symbol Sntg1
Ensembl Gene ENSMUSG00000025909
Gene Namesyntrophin, gamma 1
SynonymsSYN4, G1SYN
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location8361475-9299878 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 8679114 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Tyrosine at position 72 (*72Y)
Ref Sequence ENSEMBL: ENSMUSP00000123632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115488] [ENSMUST00000132064] [ENSMUST00000140295] [ENSMUST00000140302] [ENSMUST00000144593] [ENSMUST00000191683]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115488
AA Change: N79I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111151
Gene: ENSMUSG00000025909
AA Change: N79I

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 140 3.41e-17 SMART
PH 180 266 8.91e0 SMART
PH 284 392 7.66e-1 SMART
low complexity region 440 449 N/A INTRINSIC
low complexity region 499 514 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000132064
AA Change: N79I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122134
Gene: ENSMUSG00000025909
AA Change: N79I

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140295
AA Change: N79I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118101
Gene: ENSMUSG00000025909
AA Change: N79I

DomainStartEndE-ValueType
Blast:Tubulin_C 17 65 3e-20 BLAST
PDZ 77 150 1.84e-13 SMART
PH 190 276 8.91e0 SMART
PH 294 402 7.66e-1 SMART
low complexity region 450 459 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000140302
AA Change: N79I

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117397
Gene: ENSMUSG00000025909
AA Change: N79I

DomainStartEndE-ValueType
PDZ 66 140 3.41e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000144593
AA Change: *72Y
SMART Domains Protein: ENSMUSP00000123632
Gene: ENSMUSG00000025909
AA Change: *72Y

DomainStartEndE-ValueType
Blast:Tubulin_C 6 49 2e-18 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000191683
AA Change: N79I

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141839
Gene: ENSMUSG00000025909
AA Change: N79I

DomainStartEndE-ValueType
Blast:Tubulin_C 6 54 3e-20 BLAST
PDZ 66 139 1.84e-13 SMART
PH 179 265 8.91e0 SMART
PH 283 391 7.66e-1 SMART
low complexity region 439 448 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that typically contain 2 pleckstrin homology (PH) domains, a PDZ domain that bisects the first PH domain, and a C-terminal domain that mediates dystrophin binding. This family member plays a role in mediating gamma-enolase trafficking to the plasma membrane and in enhancing its neurotrophic activity. Mutations in this gene are associated with idiopathic scoliosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Sntg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Sntg1 APN 1 8595410 critical splice donor site probably null
IGL01536:Sntg1 APN 1 8583200 splice site probably null
IGL01558:Sntg1 APN 1 8463388 splice site probably benign
IGL01649:Sntg1 APN 1 8681969 splice site probably benign
IGL02230:Sntg1 APN 1 8681971 critical splice donor site probably null
IGL02252:Sntg1 APN 1 8414228 missense probably benign 0.00
IGL02804:Sntg1 APN 1 8803958 utr 5 prime probably benign
IGL03165:Sntg1 APN 1 8445104 missense probably damaging 1.00
IGL03400:Sntg1 APN 1 8463414 missense probably damaging 0.98
R0013:Sntg1 UTSW 1 8463462 missense probably damaging 1.00
R0079:Sntg1 UTSW 1 8679062 splice site probably benign
R0379:Sntg1 UTSW 1 8782824 missense probably damaging 1.00
R0551:Sntg1 UTSW 1 8554736 missense possibly damaging 0.73
R1081:Sntg1 UTSW 1 8445119 missense possibly damaging 0.92
R1645:Sntg1 UTSW 1 8803931 missense probably benign 0.06
R2089:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R2091:Sntg1 UTSW 1 8595539 missense probably benign 0.04
R3951:Sntg1 UTSW 1 8782901 splice site probably benign
R4152:Sntg1 UTSW 1 8583345 splice site probably null
R4153:Sntg1 UTSW 1 8583345 splice site probably null
R4154:Sntg1 UTSW 1 8583345 splice site probably null
R4847:Sntg1 UTSW 1 8595482 missense possibly damaging 0.93
R4888:Sntg1 UTSW 1 8363594 missense probably damaging 0.98
R4947:Sntg1 UTSW 1 8782798 missense probably damaging 1.00
R5065:Sntg1 UTSW 1 8363439 utr 3 prime probably benign
R5293:Sntg1 UTSW 1 8595533 missense probably damaging 1.00
R5550:Sntg1 UTSW 1 8624784 missense probably damaging 1.00
R5558:Sntg1 UTSW 1 8414271 missense possibly damaging 0.94
R5687:Sntg1 UTSW 1 8463443 missense possibly damaging 0.94
R5759:Sntg1 UTSW 1 8414270 missense probably benign 0.00
R6266:Sntg1 UTSW 1 8554729 missense possibly damaging 0.56
R6313:Sntg1 UTSW 1 8445024 splice site probably null
R6345:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6490:Sntg1 UTSW 1 8583284 missense possibly damaging 0.85
R6571:Sntg1 UTSW 1 8363528 utr 3 prime probably benign
R6736:Sntg1 UTSW 1 8445050 missense probably benign 0.16
R7112:Sntg1 UTSW 1 8448065 missense possibly damaging 0.93
R7266:Sntg1 UTSW 1 8682019 missense possibly damaging 0.81
R7414:Sntg1 UTSW 1 8448065 missense probably damaging 1.00
R7583:Sntg1 UTSW 1 8445025 critical splice donor site probably null
R7892:Sntg1 UTSW 1 8782800 missense probably damaging 1.00
R7975:Sntg1 UTSW 1 8782800 missense probably damaging 1.00
R8009:Sntg1 UTSW 1 8363570 missense probably damaging 0.96
X0026:Sntg1 UTSW 1 8414247 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GAATCGGATTTAGCCTCTCCAC -3'
(R):5'- TGAAGAGAATGCCACTACTGACG -3'

Posted On2017-07-14