Incidental Mutation 'R6075:Barhl1'
ID482680
Institutional Source Beutler Lab
Gene Symbol Barhl1
Ensembl Gene ENSMUSG00000026805
Gene NameBarH like homeobox 1
SynonymsDres115, MBH2
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location28907679-28916668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 28915219 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 154 (Y154C)
Ref Sequence ENSEMBL: ENSMUSP00000109480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050776] [ENSMUST00000113847] [ENSMUST00000113849]
Predicted Effect probably damaging
Transcript: ENSMUST00000050776
AA Change: Y154C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053147
Gene: ENSMUSG00000026805
AA Change: Y154C

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113847
AA Change: Y154C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109478
Gene: ENSMUSG00000026805
AA Change: Y154C

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113849
AA Change: Y154C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109480
Gene: ENSMUSG00000026805
AA Change: Y154C

DomainStartEndE-ValueType
low complexity region 33 54 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
HOX 178 240 4.35e-27 SMART
low complexity region 309 321 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124059
SMART Domains Protein: ENSMUSP00000134363
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
low complexity region 76 95 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174027
SMART Domains Protein: ENSMUSP00000134118
Gene: ENSMUSG00000026805

DomainStartEndE-ValueType
HOX 1 32 2.5e-3 SMART
low complexity region 101 113 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive hearing loss starting at 2 weeks of age. Animals are completely deaf by 10 months of age and show degeneration of the inner and outer cochlear hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Barhl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Barhl1 APN 2 28915546 missense probably benign 0.03
IGL02337:Barhl1 APN 2 28911419 missense probably damaging 1.00
IGL03113:Barhl1 APN 2 28915456 missense probably benign 0.03
R0449:Barhl1 UTSW 2 28915292 missense probably benign 0.06
R1675:Barhl1 UTSW 2 28915411 missense possibly damaging 0.86
R1829:Barhl1 UTSW 2 28909845 missense probably damaging 1.00
R3615:Barhl1 UTSW 2 28911550 missense possibly damaging 0.75
R3616:Barhl1 UTSW 2 28911550 missense possibly damaging 0.75
R4937:Barhl1 UTSW 2 28909773 missense probably damaging 1.00
R5481:Barhl1 UTSW 2 28915340 missense probably damaging 0.98
R6727:Barhl1 UTSW 2 28915483 missense probably benign 0.01
R6728:Barhl1 UTSW 2 28915483 missense probably benign 0.01
R7096:Barhl1 UTSW 2 28909714 missense probably benign
R7123:Barhl1 UTSW 2 28909931 splice site probably null
R7336:Barhl1 UTSW 2 28909843 missense probably benign 0.40
R7339:Barhl1 UTSW 2 28909887 missense probably damaging 1.00
R7584:Barhl1 UTSW 2 28909791 missense probably damaging 0.99
X0065:Barhl1 UTSW 2 28915339 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCTCAACCTTTGGAGCTGG -3'
(R):5'- TTGGACTCTCACCTGCAAC -3'

Posted On2017-07-14