Incidental Mutation 'R6075:Hat1'
ID482682
Institutional Source Beutler Lab
Gene Symbol Hat1
Ensembl Gene ENSMUSG00000027018
Gene Namehistone aminotransferase 1
Synonyms2410071B14Rik, KAT1
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location71388958-71441622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71410241 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 93 (D93V)
Ref Sequence ENSEMBL: ENSMUSP00000107750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028408] [ENSMUST00000112122]
Predicted Effect probably benign
Transcript: ENSMUST00000028408
AA Change: D93V

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000028408
Gene: ENSMUSG00000027018
AA Change: D93V

DomainStartEndE-ValueType
Pfam:Hat1_N 23 184 1.3e-49 PFAM
coiled coil region 386 416 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112122
AA Change: D93V

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107750
Gene: ENSMUSG00000027018
AA Change: D93V

DomainStartEndE-ValueType
Pfam:Hat1_N 22 184 4.4e-49 PFAM
coiled coil region 393 423 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144888
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type B histone acetyltransferase (HAT) that is involved in the rapid acetylation of newly synthesized cytoplasmic histones, which are in turn imported into the nucleus for de novo deposition onto nascent DNA chains. Histone acetylation, particularly of histone H4, plays an important role in replication-dependent chromatin assembly. Specifically, this HAT can acetylate soluble but not nucleosomal histone H4 at lysines 5 and 12, and to a lesser degree, histone H2A at lysine 5. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal, perinatal and neonatal lethality with impaired lung maturation, atelectasis, respiratory failure, craniofacial defects and decreased proliferation of mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Hat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Hat1 APN 2 71421260 missense probably damaging 1.00
IGL02945:Hat1 APN 2 71420693 missense probably benign 0.01
IGL02796:Hat1 UTSW 2 71420356 critical splice donor site probably null
R0789:Hat1 UTSW 2 71421744 splice site probably benign
R0907:Hat1 UTSW 2 71420617 nonsense probably null
R1412:Hat1 UTSW 2 71420617 nonsense probably null
R1571:Hat1 UTSW 2 71434175 missense probably benign
R1868:Hat1 UTSW 2 71421283 nonsense probably null
R1981:Hat1 UTSW 2 71389977 missense probably benign 0.01
R2064:Hat1 UTSW 2 71410160 missense possibly damaging 0.71
R2089:Hat1 UTSW 2 71434034 missense probably benign 0.12
R2091:Hat1 UTSW 2 71434034 missense probably benign 0.12
R2091:Hat1 UTSW 2 71434034 missense probably benign 0.12
R4115:Hat1 UTSW 2 71441222 missense probably benign 0.01
R5579:Hat1 UTSW 2 71410238 missense possibly damaging 0.86
R5650:Hat1 UTSW 2 71434034 missense probably benign 0.12
R5681:Hat1 UTSW 2 71434209 splice site probably null
R5895:Hat1 UTSW 2 71409013 missense possibly damaging 0.67
R6621:Hat1 UTSW 2 71421715 missense probably benign 0.00
R7155:Hat1 UTSW 2 71421251 missense possibly damaging 0.95
R7506:Hat1 UTSW 2 71420347 missense probably damaging 1.00
R7644:Hat1 UTSW 2 71410181 missense probably damaging 1.00
R8255:Hat1 UTSW 2 71409003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGATGTAGTTTAACTTCACAGG -3'
(R):5'- ACACTTCCTCATCCTGAAGC -3'

Posted On2017-07-14