Incidental Mutation 'R6075:Ccdc34'
ID482683
Institutional Source Beutler Lab
Gene Symbol Ccdc34
Ensembl Gene ENSMUSG00000027160
Gene Namecoiled-coil domain containing 34
Synonyms
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location110017817-110173360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110044235 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 313 (I313T)
Ref Sequence ENSEMBL: ENSMUSP00000028580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028580]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028580
AA Change: I313T

PolyPhen 2 Score 0.773 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028580
Gene: ENSMUSG00000027160
AA Change: I313T

DomainStartEndE-ValueType
low complexity region 29 40 N/A INTRINSIC
Pfam:DUF4207 62 315 5.6e-56 PFAM
low complexity region 338 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000078939
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123633
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126990
Predicted Effect probably benign
Transcript: ENSMUST00000127630
SMART Domains Protein: ENSMUSP00000130554
Gene: ENSMUSG00000027160

DomainStartEndE-ValueType
Pfam:DUF4207 25 174 6.3e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150183
SMART Domains Protein: ENSMUSP00000127363
Gene: ENSMUSG00000027160

DomainStartEndE-ValueType
Pfam:DUF4207 31 139 3.7e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155110
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Ccdc34
AlleleSourceChrCoordTypePredicted EffectPPH Score
LCD18:Ccdc34 UTSW 2 110016318 unclassified probably benign
R1808:Ccdc34 UTSW 2 110044256 missense probably benign 0.15
R2011:Ccdc34 UTSW 2 110044304 missense possibly damaging 0.93
R2025:Ccdc34 UTSW 2 110032386 missense possibly damaging 0.95
R3852:Ccdc34 UTSW 2 110032428 missense possibly damaging 0.95
R4968:Ccdc34 UTSW 2 110040733 critical splice donor site probably null
R4986:Ccdc34 UTSW 2 110017869 start codon destroyed probably null 0.02
R6103:Ccdc34 UTSW 2 110018007 missense probably benign 0.04
R6294:Ccdc34 UTSW 2 110018151 missense probably benign 0.08
R7856:Ccdc34 UTSW 2 110044227 nonsense probably null
X0025:Ccdc34 UTSW 2 110044312 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGGCCTCAAGTTTTAAGCTATC -3'
(R):5'- AAATGTAAGCTCCGGGTAGC -3'

Posted On2017-07-14