Incidental Mutation 'R6075:Cyp2j11'
ID482688
Institutional Source Beutler Lab
Gene Symbol Cyp2j11
Ensembl Gene ENSMUSG00000066097
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 11
SynonymsCyp2j11-ps
MMRRC Submission 044236-MU
Accession Numbers

Genbank: NM_001004141; MGI: 2140224

Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location96294508-96348662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 96345085 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 125 (N125H)
Ref Sequence ENSEMBL: ENSMUSP00000132180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015368]
Predicted Effect probably benign
Transcript: ENSMUST00000015368
AA Change: N125H

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132180
Gene: ENSMUSG00000066097
AA Change: N125H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:p450 44 500 4.3e-133 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Cyp2j11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Cyp2j11 APN 4 96339095 missense probably benign
IGL01816:Cyp2j11 APN 4 96294924 missense probably damaging 1.00
IGL02406:Cyp2j11 APN 4 96348539 missense possibly damaging 0.56
E7848:Cyp2j11 UTSW 4 96319365 missense probably benign 0.09
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R0020:Cyp2j11 UTSW 4 96307404 missense probably benign 0.19
R1298:Cyp2j11 UTSW 4 96307260 critical splice donor site probably null
R1411:Cyp2j11 UTSW 4 96345216 missense probably benign 0.03
R1428:Cyp2j11 UTSW 4 96294880 missense probably benign 0.01
R1740:Cyp2j11 UTSW 4 96319376 missense probably benign 0.00
R1818:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1819:Cyp2j11 UTSW 4 96297739 missense probably damaging 0.97
R1917:Cyp2j11 UTSW 4 96339974 missense probably damaging 1.00
R2084:Cyp2j11 UTSW 4 96339201 missense probably damaging 1.00
R2146:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R2148:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R2150:Cyp2j11 UTSW 4 96316358 missense probably damaging 1.00
R4963:Cyp2j11 UTSW 4 96316382 missense probably damaging 1.00
R5335:Cyp2j11 UTSW 4 96307352 missense probably damaging 1.00
R5450:Cyp2j11 UTSW 4 96339876 missense probably benign 0.44
R5688:Cyp2j11 UTSW 4 96345121 missense probably damaging 1.00
R5978:Cyp2j11 UTSW 4 96319352 missense probably damaging 1.00
R6061:Cyp2j11 UTSW 4 96348616 start gained probably benign
R6912:Cyp2j11 UTSW 4 96294871 missense probably benign 0.00
R7338:Cyp2j11 UTSW 4 96307287 missense possibly damaging 0.64
R7394:Cyp2j11 UTSW 4 96316440 missense probably benign 0.00
R7464:Cyp2j11 UTSW 4 96345120 missense probably damaging 1.00
R8152:Cyp2j11 UTSW 4 96307292 missense probably damaging 1.00
Z1176:Cyp2j11 UTSW 4 96307303 missense probably damaging 0.99
Z1176:Cyp2j11 UTSW 4 96307436 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGAAACAATATTATCAGCATCCC -3'
(R):5'- AGGTCATGAGTACCTGAGCC -3'

Posted On2017-07-14