Incidental Mutation 'R6075:Fbxo21'
ID482694
Institutional Source Beutler Lab
Gene Symbol Fbxo21
Ensembl Gene ENSMUSG00000032898
Gene NameF-box protein 21
Synonyms
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R6075 (G1)
Quality Score121.008
Status Not validated
Chromosome5
Chromosomal Location117976730-118010201 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117988883 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 233 (R233H)
Ref Sequence ENSEMBL: ENSMUSP00000143873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035579] [ENSMUST00000202447]
Predicted Effect probably damaging
Transcript: ENSMUST00000035579
AA Change: R233H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035506
Gene: ENSMUSG00000032898
AA Change: R233H

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200780
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201427
Predicted Effect unknown
Transcript: ENSMUST00000201611
AA Change: R176H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201889
Predicted Effect probably damaging
Transcript: ENSMUST00000202447
AA Change: R233H

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143873
Gene: ENSMUSG00000032898
AA Change: R233H

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
Blast:FBOX 33 73 6e-8 BLAST
Pfam:Transglut_core2 215 390 3e-43 PFAM
low complexity region 482 491 N/A INTRINSIC
YccV-like 500 597 8.22e-39 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Fbxo21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Fbxo21 APN 5 117988790 missense probably benign 0.04
IGL02131:Fbxo21 APN 5 118002090 missense possibly damaging 0.76
IGL02156:Fbxo21 APN 5 117994668 splice site probably benign
IGL02195:Fbxo21 APN 5 118002154 missense probably damaging 1.00
IGL02702:Fbxo21 APN 5 118000510 missense probably damaging 1.00
PIT1430001:Fbxo21 UTSW 5 117977866 missense possibly damaging 0.68
R0008:Fbxo21 UTSW 5 118008013 missense possibly damaging 0.63
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0055:Fbxo21 UTSW 5 118000490 missense probably benign 0.12
R0089:Fbxo21 UTSW 5 118008143 missense probably benign
R0101:Fbxo21 UTSW 5 117995456 missense probably damaging 1.00
R0815:Fbxo21 UTSW 5 117995508 splice site probably benign
R0866:Fbxo21 UTSW 5 117977033 missense probably benign 0.01
R1673:Fbxo21 UTSW 5 118008064 missense probably benign 0.27
R2048:Fbxo21 UTSW 5 118008104 missense probably damaging 1.00
R2063:Fbxo21 UTSW 5 117976966 missense probably benign 0.45
R2161:Fbxo21 UTSW 5 117995386 missense probably damaging 1.00
R2224:Fbxo21 UTSW 5 118008123 missense probably damaging 1.00
R3872:Fbxo21 UTSW 5 118000329 missense possibly damaging 0.70
R4750:Fbxo21 UTSW 5 118000468 missense probably benign 0.10
R5807:Fbxo21 UTSW 5 117976868 missense probably benign 0.01
R6528:Fbxo21 UTSW 5 118000356 missense probably benign 0.25
R7494:Fbxo21 UTSW 5 118000323 missense possibly damaging 0.86
R7498:Fbxo21 UTSW 5 118002174 critical splice donor site probably null
R7801:Fbxo21 UTSW 5 117986124 missense probably damaging 0.96
R7857:Fbxo21 UTSW 5 117988813 missense probably benign 0.21
R7940:Fbxo21 UTSW 5 117988813 missense probably benign 0.21
R8116:Fbxo21 UTSW 5 117990854 missense possibly damaging 0.70
Z1177:Fbxo21 UTSW 5 117989171 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATGCCTAACATCCCCAGGAG -3'
(R):5'- TGACTGATAAGAGCCTGGCAGG -3'

Posted On2017-07-14