Incidental Mutation 'R6075:Nova2'
ID482697
Institutional Source Beutler Lab
Gene Symbol Nova2
Ensembl Gene ENSMUSG00000030411
Gene Nameneuro-oncological ventral antigen 2
SynonymsLOC384569
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6075 (G1)
Quality Score125.008
Status Not validated
Chromosome7
Chromosomal Location18925888-18965319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18957869 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 244 (A244T)
Ref Sequence ENSEMBL: ENSMUSP00000151939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032571] [ENSMUST00000220302]
Predicted Effect unknown
Transcript: ENSMUST00000032571
AA Change: A308T
SMART Domains Protein: ENSMUSP00000032571
Gene: ENSMUSG00000030411
AA Change: A308T

DomainStartEndE-ValueType
KH 31 104 2.19e-13 SMART
KH 129 201 6.95e-16 SMART
low complexity region 232 270 N/A INTRINSIC
low complexity region 290 393 N/A INTRINSIC
KH 405 478 1.94e-14 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000134257
Gene: ENSMUSG00000108585
AA Change: A244T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
KH 95 168 2.19e-13 SMART
KH 193 265 6.95e-16 SMART
low complexity region 296 334 N/A INTRINSIC
low complexity region 354 457 N/A INTRINSIC
KH 469 542 1.94e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181954
Predicted Effect unknown
Transcript: ENSMUST00000220302
AA Change: A244T
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in postnatal lethality, abolished long term potentiation of the small inhibitory postsynaptic current but not the excitatory postsynaptic current, and no pairing-induced potentiation of small inhibitory postsynatpic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Nova2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03088:Nova2 APN 7 18950569 missense unknown
R1529:Nova2 UTSW 7 18957554 missense probably damaging 0.99
R1858:Nova2 UTSW 7 18958401 missense probably damaging 1.00
R5130:Nova2 UTSW 7 18926144 missense unknown
R5402:Nova2 UTSW 7 18958446 missense probably damaging 1.00
R6077:Nova2 UTSW 7 18957869 missense unknown
R6132:Nova2 UTSW 7 18957869 missense unknown
R6134:Nova2 UTSW 7 18957869 missense unknown
R6727:Nova2 UTSW 7 18958494 missense probably damaging 1.00
R7759:Nova2 UTSW 7 18958251 missense
R7895:Nova2 UTSW 7 18942345 missense
Z1176:Nova2 UTSW 7 18958449 missense unknown
Predicted Primers PCR Primer
(F):5'- GGCATCAACCTGCAAGAGC -3'
(R):5'- GATCTCCACCAGCTCCTTGG -3'

Posted On2017-07-14