Incidental Mutation 'R6075:Nae1'
ID482703
Institutional Source Beutler Lab
Gene Symbol Nae1
Ensembl Gene ENSMUSG00000031878
Gene NameNEDD8 activating enzyme E1 subunit 1
SynonymsAppbp1
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location104511028-104534637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104524369 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 196 (L196H)
Ref Sequence ENSEMBL: ENSMUSP00000034349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034349] [ENSMUST00000162466]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034349
AA Change: L196H

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034349
Gene: ENSMUSG00000031878
AA Change: L196H

DomainStartEndE-ValueType
Pfam:ThiF 13 533 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159696
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161474
Predicted Effect probably benign
Transcript: ENSMUST00000162466
AA Change: L172H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000125456
Gene: ENSMUSG00000031878
AA Change: L172H

DomainStartEndE-ValueType
PDB:3GZN|C 1 510 N/A PDB
SCOP:d1jw9b_ 9 145 5e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213067
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the beta-amyloid precursor protein. Beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. In addition, the encoded protein can form a heterodimer with UBE1C and bind and activate NEDD8, a ubiquitin-like protein. This protein is required for cell cycle progression through the S/M checkpoint. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Nae1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Nae1 APN 8 104526381 missense possibly damaging 0.70
IGL00585:Nae1 APN 8 104526278 critical splice donor site probably null
IGL00765:Nae1 APN 8 104517950 splice site probably benign
IGL01420:Nae1 APN 8 104523165 missense probably benign 0.00
IGL02314:Nae1 APN 8 104526306 missense probably damaging 0.99
IGL02565:Nae1 APN 8 104511209 missense probably damaging 1.00
IGL03202:Nae1 APN 8 104518179 splice site probably benign
IGL03266:Nae1 APN 8 104513196 splice site probably benign
pixy_stix UTSW 8 104519784 missense probably damaging 1.00
taebaeksan UTSW 8 104530391 critical splice donor site probably null
R0436:Nae1 UTSW 8 104523236 splice site probably benign
R0687:Nae1 UTSW 8 104513244 missense probably damaging 1.00
R1500:Nae1 UTSW 8 104523584 missense probably benign 0.06
R1746:Nae1 UTSW 8 104527385 missense possibly damaging 0.74
R2241:Nae1 UTSW 8 104519788 missense probably benign 0.00
R2255:Nae1 UTSW 8 104530068 missense probably damaging 1.00
R4821:Nae1 UTSW 8 104519784 missense probably damaging 1.00
R4928:Nae1 UTSW 8 104516142 missense possibly damaging 0.76
R5062:Nae1 UTSW 8 104516702 missense possibly damaging 0.60
R5240:Nae1 UTSW 8 104523144 intron probably benign
R5250:Nae1 UTSW 8 104530391 critical splice donor site probably null
R6052:Nae1 UTSW 8 104534544 missense probably benign 0.01
R6108:Nae1 UTSW 8 104527402 missense probably benign 0.07
R6318:Nae1 UTSW 8 104523637 missense probably benign 0.40
R7120:Nae1 UTSW 8 104526278 critical splice donor site probably null
R7202:Nae1 UTSW 8 104523583 missense possibly damaging 0.77
R7491:Nae1 UTSW 8 104518239 missense probably benign 0.13
R7659:Nae1 UTSW 8 104516164 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GAGTAGCTCTGTGAGTAAAATGTG -3'
(R):5'- CGAGGCTAGAGTGAGACCCT -3'

Posted On2017-07-14