Incidental Mutation 'R6075:Ptpn9'
ID482704
Institutional Source Beutler Lab
Gene Symbol Ptpn9
Ensembl Gene ENSMUSG00000032290
Gene Nameprotein tyrosine phosphatase, non-receptor type 9
SynonymsMeg2
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.467) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location56994923-57062807 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57061146 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 590 (M590K)
Ref Sequence ENSEMBL: ENSMUSP00000034832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034832]
Predicted Effect probably benign
Transcript: ENSMUST00000034832
AA Change: M590K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034832
Gene: ENSMUSG00000032290
AA Change: M590K

DomainStartEndE-ValueType
CRAL_TRIO_N 43 68 1.14e0 SMART
SEC14 90 240 7.33e-40 SMART
PTPc 302 576 1.01e-136 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215707
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal domain that shares a significant similarity with yeast SEC14, which is a protein that has phosphatidylinositol transfer activity and is required for protein secretion through the Golgi complex in yeast. This PTP was found to be activated by polyphosphoinositide, and is thought to be involved in signaling events regulating phagocytosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display hemorrhages, craniofacial anomalies, neural tube defects such as exencephaly and meningomyeloceles, cerebral infarctions, abnormal bone development, and >90% late embryonic lethality in addition to severe defectsin T lymphocyte and platelet activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Ptpn9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01072:Ptpn9 APN 9 57036703 missense possibly damaging 0.68
IGL01388:Ptpn9 APN 9 57036718 missense probably benign 0.00
IGL01953:Ptpn9 APN 9 57056788 missense possibly damaging 0.69
IGL02525:Ptpn9 APN 9 57036725 nonsense probably null
IGL03294:Ptpn9 APN 9 57027387 missense possibly damaging 0.79
BB009:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
BB019:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
PIT4486001:Ptpn9 UTSW 9 57061003 missense probably damaging 0.99
R0530:Ptpn9 UTSW 9 57061133 missense probably benign
R1617:Ptpn9 UTSW 9 57027408 missense possibly damaging 0.79
R1964:Ptpn9 UTSW 9 57059912 missense probably damaging 1.00
R2426:Ptpn9 UTSW 9 57027428 missense possibly damaging 0.61
R4394:Ptpn9 UTSW 9 57036563 missense possibly damaging 0.91
R4606:Ptpn9 UTSW 9 57022211 missense possibly damaging 0.71
R4658:Ptpn9 UTSW 9 57020037 missense probably benign 0.01
R4660:Ptpn9 UTSW 9 57036498 missense probably benign 0.17
R5141:Ptpn9 UTSW 9 57036676 missense possibly damaging 0.56
R5150:Ptpn9 UTSW 9 57036670 missense probably benign
R5289:Ptpn9 UTSW 9 57060063 critical splice donor site probably null
R5389:Ptpn9 UTSW 9 57056837 intron probably benign
R5422:Ptpn9 UTSW 9 57033157 missense probably damaging 1.00
R5437:Ptpn9 UTSW 9 57020037 missense possibly damaging 0.80
R6084:Ptpn9 UTSW 9 57033163 nonsense probably null
R6481:Ptpn9 UTSW 9 57023040 missense probably damaging 1.00
R7120:Ptpn9 UTSW 9 57059882 missense probably damaging 1.00
R7194:Ptpn9 UTSW 9 57022286 missense probably damaging 1.00
R7195:Ptpn9 UTSW 9 57022249 missense probably benign 0.02
R7349:Ptpn9 UTSW 9 57044376 missense probably benign 0.16
R7439:Ptpn9 UTSW 9 57027433 nonsense probably null
R7441:Ptpn9 UTSW 9 57027433 nonsense probably null
R7801:Ptpn9 UTSW 9 57061013 missense probably benign 0.36
R7879:Ptpn9 UTSW 9 57056726 missense possibly damaging 0.50
R7932:Ptpn9 UTSW 9 57036616 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TCTGCTCACTGGACATCTGC -3'
(R):5'- GGCCCTTTCTAGTGGCAAGTTC -3'

Posted On2017-07-14