Incidental Mutation 'R6075:Scap'
ID482705
Institutional Source Beutler Lab
Gene Symbol Scap
Ensembl Gene ENSMUSG00000032485
Gene NameSREBF chaperone
Synonyms
MMRRC Submission 044236-MU
Accession Numbers

Genbank: NM_001001144; MGI: 2135958

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6075 (G1)
Quality Score213.009
Status Not validated
Chromosome9
Chromosomal Location110333288-110384950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110378777 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 518 (R518H)
Ref Sequence ENSEMBL: ENSMUSP00000095953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098350]
Predicted Effect probably damaging
Transcript: ENSMUST00000098350
AA Change: R518H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095953
Gene: ENSMUSG00000032485
AA Change: R518H

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 43 54 N/A INTRINSIC
low complexity region 153 165 N/A INTRINSIC
Pfam:Patched 279 504 4.7e-24 PFAM
Pfam:Sterol-sensing 308 459 7.6e-54 PFAM
transmembrane domain 515 534 N/A INTRINSIC
transmembrane domain 711 733 N/A INTRINSIC
low complexity region 741 751 N/A INTRINSIC
WD40 765 802 1.79e-1 SMART
low complexity region 847 865 N/A INTRINSIC
low complexity region 928 944 N/A INTRINSIC
WD40 953 990 9.86e1 SMART
low complexity region 1050 1060 N/A INTRINSIC
WD40 1062 1102 4.18e-2 SMART
WD40 1105 1143 5.64e-8 SMART
WD40 1147 1183 2.4e-1 SMART
WD40 1186 1223 2.56e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196424
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196775
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a sterol sensing domain (SSD) and seven WD domains. In the presence of cholesterol, this protein binds to sterol regulatory element binding proteins (SREBPs) and mediates their transport from the ER to the Golgi. The SREBPs are then proteolytically cleaved and regulate sterol biosynthesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit decreased body size. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted, other(1) Gene trapped(22)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Scap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00581:Scap APN 9 110376631 missense probably damaging 1.00
IGL01012:Scap APN 9 110362420 missense probably damaging 1.00
IGL01487:Scap APN 9 110377734 critical splice donor site probably null
IGL01634:Scap APN 9 110378789 critical splice donor site probably null
IGL01725:Scap APN 9 110381554 unclassified probably benign
IGL01939:Scap APN 9 110379481 missense probably benign 0.02
IGL02106:Scap APN 9 110381656 unclassified probably benign
IGL02423:Scap APN 9 110378617 missense probably benign 0.02
IGL02487:Scap APN 9 110378690 missense probably benign 0.19
IGL02545:Scap APN 9 110378690 missense probably benign 0.19
IGL03226:Scap APN 9 110384267 missense possibly damaging 0.93
IGL03331:Scap APN 9 110380236 unclassified probably null
3-1:Scap UTSW 9 110372968 intron probably benign
R0027:Scap UTSW 9 110379730 missense probably benign 0.06
R0089:Scap UTSW 9 110372222 missense possibly damaging 0.81
R0742:Scap UTSW 9 110381259 missense probably damaging 1.00
R1416:Scap UTSW 9 110384773 missense probably damaging 1.00
R1785:Scap UTSW 9 110374055 missense probably damaging 0.97
R1996:Scap UTSW 9 110372971 intron probably benign
R2114:Scap UTSW 9 110381273 missense probably damaging 0.99
R2189:Scap UTSW 9 110377693 missense probably damaging 1.00
R2233:Scap UTSW 9 110381593 missense probably damaging 0.98
R2234:Scap UTSW 9 110381593 missense probably damaging 0.98
R2656:Scap UTSW 9 110374019 missense probably damaging 1.00
R3176:Scap UTSW 9 110374025 missense probably benign
R3237:Scap UTSW 9 110379582 missense probably damaging 0.96
R3276:Scap UTSW 9 110374025 missense probably benign
R3623:Scap UTSW 9 110380203 missense probably damaging 0.99
R3826:Scap UTSW 9 110381297 missense probably benign
R4859:Scap UTSW 9 110374342 unclassified probably benign
R4993:Scap UTSW 9 110378390 missense probably damaging 1.00
R5052:Scap UTSW 9 110353152 missense possibly damaging 0.89
R5330:Scap UTSW 9 110381633 missense probably benign 0.00
R5331:Scap UTSW 9 110381633 missense probably benign 0.00
R5383:Scap UTSW 9 110374529 missense probably damaging 0.99
R5410:Scap UTSW 9 110374182 unclassified probably null
R5531:Scap UTSW 9 110381429 missense possibly damaging 0.59
R5567:Scap UTSW 9 110377644 missense probably damaging 1.00
R5636:Scap UTSW 9 110380594 missense probably damaging 0.99
R5637:Scap UTSW 9 110381572 missense possibly damaging 0.94
R5859:Scap UTSW 9 110374047 missense probably benign 0.14
R5923:Scap UTSW 9 110383580 missense probably damaging 0.98
R5945:Scap UTSW 9 110384596 missense probably benign 0.00
R5987:Scap UTSW 9 110381151 missense probably damaging 1.00
R6130:Scap UTSW 9 110380379 missense possibly damaging 0.95
R6190:Scap UTSW 9 110374067 missense probably benign 0.01
R6567:Scap UTSW 9 110383562 missense probably damaging 1.00
R6999:Scap UTSW 9 110384647 missense probably damaging 1.00
R7098:Scap UTSW 9 110372242 missense possibly damaging 0.89
R7386:Scap UTSW 9 110373169 missense probably benign 0.00
R7642:Scap UTSW 9 110374013 missense probably damaging 1.00
R7726:Scap UTSW 9 110378367 synonymous probably null
R7898:Scap UTSW 9 110384743 missense possibly damaging 0.74
X0064:Scap UTSW 9 110377645 missense probably damaging 1.00
Z1088:Scap UTSW 9 110372336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACCTAAACAAGCGGCTG -3'
(R):5'- TGACTTTATCCTGGAGAATCCCTG -3'

Posted On2017-07-14