Incidental Mutation 'R6075:Ank3'
ID482707
Institutional Source Beutler Lab
Gene Symbol Ank3
Ensembl Gene ENSMUSG00000069601
Gene Nameankyrin 3, epithelial
SynonymsAnkyrin-3, Ankyrin-G, AnkG, Ank-3, 2900054D09Rik
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.812) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location69398773-70027438 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70002565 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 1566 (R1566K)
Ref Sequence ENSEMBL: ENSMUSP00000138347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047061] [ENSMUST00000054167] [ENSMUST00000092431] [ENSMUST00000092432] [ENSMUST00000092433] [ENSMUST00000092434] [ENSMUST00000181974] [ENSMUST00000182029] [ENSMUST00000182155] [ENSMUST00000182207] [ENSMUST00000182269] [ENSMUST00000182437] [ENSMUST00000182439] [ENSMUST00000182692] [ENSMUST00000182795] [ENSMUST00000182884] [ENSMUST00000182972] [ENSMUST00000182992] [ENSMUST00000183023] [ENSMUST00000183074] [ENSMUST00000183148] [ENSMUST00000183169] [ENSMUST00000183261] [ENSMUST00000185582] [ENSMUST00000218680]
Predicted Effect probably benign
Transcript: ENSMUST00000047061
AA Change: R678K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000045834
Gene: ENSMUSG00000069601
AA Change: R678K

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054167
AA Change: R1762K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000061698
Gene: ENSMUSG00000069601
AA Change: R1762K

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1760 1780 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092431
AA Change: R1780K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000090087
Gene: ENSMUSG00000069601
AA Change: R1780K

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 885 902 N/A INTRINSIC
ZU5 962 1066 2.27e-58 SMART
DEATH 1447 1541 5.8e-33 SMART
low complexity region 1778 1798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092432
AA Change: R1783K

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000090088
Gene: ENSMUSG00000069601
AA Change: R1783K

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 888 905 N/A INTRINSIC
ZU5 965 1069 2.27e-58 SMART
DEATH 1450 1544 5.8e-33 SMART
low complexity region 1781 1801 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092433
AA Change: R934K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090089
Gene: ENSMUSG00000069601
AA Change: R934K

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092434
AA Change: R1801K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000090090
Gene: ENSMUSG00000069601
AA Change: R1801K

DomainStartEndE-ValueType
ANK 56 85 6.5e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7.1e-9 SMART
ANK 155 183 4.2e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.4e-7 SMART
ANK 250 279 3.8e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.3e-7 SMART
ANK 349 378 9.9e-8 SMART
ANK 382 411 2.5e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 6e-8 SMART
ANK 481 510 7.4e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.2e-8 SMART
ANK 580 609 3e-6 SMART
ANK 613 642 5.4e-8 SMART
ANK 646 675 3.3e-6 SMART
ANK 679 708 4.3e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 9.1e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.8e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000181974
AA Change: R738K
SMART Domains Protein: ENSMUSP00000138285
Gene: ENSMUSG00000069601
AA Change: R738K

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 736 756 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182029
AA Change: R934K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000138337
Gene: ENSMUSG00000069601
AA Change: R934K

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 932 952 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182155
AA Change: R1566K

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138347
Gene: ENSMUSG00000069601
AA Change: R1566K

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 867 884 N/A INTRINSIC
ZU5 944 1048 2.27e-58 SMART
DEATH 1429 1523 5.8e-33 SMART
low complexity region 1564 1584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182207
AA Change: R299K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138531
Gene: ENSMUSG00000069601
AA Change: R299K

DomainStartEndE-ValueType
DEATH 59 153 5.8e-33 SMART
low complexity region 297 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182269
AA Change: R725K

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138123
Gene: ENSMUSG00000069601
AA Change: R725K

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 886 895 N/A INTRINSIC
low complexity region 897 909 N/A INTRINSIC
low complexity region 935 947 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182437
AA Change: R725K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138586
Gene: ENSMUSG00000069601
AA Change: R725K

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 723 743 N/A INTRINSIC
low complexity region 869 878 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 918 930 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182439
AA Change: R678K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000138356
Gene: ENSMUSG00000069601
AA Change: R678K

DomainStartEndE-ValueType
ZU5 56 160 2.27e-58 SMART
DEATH 541 635 5.8e-33 SMART
low complexity region 676 696 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182606
Predicted Effect probably benign
Transcript: ENSMUST00000182665
Predicted Effect probably benign
Transcript: ENSMUST00000182692
AA Change: R841K

PolyPhen 2 Score 0.339 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000138623
Gene: ENSMUSG00000069601
AA Change: R841K

DomainStartEndE-ValueType
low complexity region 39 56 N/A INTRINSIC
ZU5 116 220 2.27e-58 SMART
DEATH 601 695 5.8e-33 SMART
low complexity region 839 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182795
AA Change: R721K

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138413
Gene: ENSMUSG00000069601
AA Change: R721K

DomainStartEndE-ValueType
ZU5 111 215 2.27e-58 SMART
DEATH 584 678 7.66e-33 SMART
low complexity region 719 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182884
AA Change: R1801K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138326
Gene: ENSMUSG00000069601
AA Change: R1801K

DomainStartEndE-ValueType
ANK 56 85 6.4e-8 SMART
ANK 89 118 1.1e-8 SMART
ANK 122 151 7e-9 SMART
ANK 155 183 4.1e-2 SMART
ANK 184 213 1.7e-1 SMART
ANK 217 246 8.2e-7 SMART
ANK 250 279 3.7e-9 SMART
ANK 283 312 2.1e-6 SMART
ANK 316 345 5.2e-7 SMART
ANK 349 378 9.7e-8 SMART
ANK 382 411 2.4e-9 SMART
ANK 415 444 1.3e-6 SMART
ANK 448 477 5.9e-8 SMART
ANK 481 510 7.3e-7 SMART
ANK 514 543 1.9e-9 SMART
ANK 547 576 2.1e-8 SMART
ANK 580 609 2.9e-6 SMART
ANK 613 642 5.3e-8 SMART
ANK 646 675 3.2e-6 SMART
ANK 679 708 4.2e-6 SMART
ANK 712 741 3.9e-8 SMART
ANK 745 774 8.9e-8 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 906 923 N/A INTRINSIC
ZU5 983 1087 1.1e-60 SMART
DEATH 1468 1562 3.7e-35 SMART
low complexity region 1799 1819 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182972
AA Change: R1021K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138481
Gene: ENSMUSG00000069601
AA Change: R1021K

DomainStartEndE-ValueType
ANK 4 33 1.43e-5 SMART
low complexity region 61 72 N/A INTRINSIC
low complexity region 126 143 N/A INTRINSIC
ZU5 203 307 2.27e-58 SMART
DEATH 688 782 5.8e-33 SMART
low complexity region 1019 1039 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182992
AA Change: R2462K
SMART Domains Protein: ENSMUSP00000138686
Gene: ENSMUSG00000069601
AA Change: R2462K

DomainStartEndE-ValueType
coiled coil region 4 38 N/A INTRINSIC
ANK 73 102 1.01e-5 SMART
ANK 106 135 1.66e-6 SMART
ANK 139 168 1.1e-6 SMART
ANK 172 200 6.51e0 SMART
ANK 201 230 2.6e1 SMART
ANK 242 271 1.31e-4 SMART
ANK 275 304 5.88e-7 SMART
ANK 308 337 3.23e-4 SMART
ANK 341 370 8.07e-5 SMART
ANK 374 403 1.53e-5 SMART
ANK 407 436 3.88e-7 SMART
ANK 440 469 1.99e-4 SMART
ANK 473 502 9.41e-6 SMART
ANK 506 535 1.14e-4 SMART
ANK 539 568 2.94e-7 SMART
ANK 572 601 3.33e-6 SMART
ANK 605 634 4.56e-4 SMART
ANK 638 667 8.19e-6 SMART
ANK 671 700 5.24e-4 SMART
ANK 704 733 6.46e-4 SMART
ANK 737 766 6.21e-6 SMART
ANK 770 799 1.43e-5 SMART
low complexity region 827 838 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
ZU5 990 1094 2.27e-58 SMART
low complexity region 1515 1536 N/A INTRINSIC
low complexity region 1745 1762 N/A INTRINSIC
low complexity region 1805 1827 N/A INTRINSIC
low complexity region 1876 1897 N/A INTRINSIC
low complexity region 1969 1984 N/A INTRINSIC
DEATH 2325 2419 7.66e-33 SMART
low complexity region 2460 2480 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183001
Predicted Effect unknown
Transcript: ENSMUST00000183023
AA Change: R397K
SMART Domains Protein: ENSMUSP00000138450
Gene: ENSMUSG00000069601
AA Change: R397K

DomainStartEndE-ValueType
DEATH 260 354 7.66e-33 SMART
low complexity region 395 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183074
AA Change: R921K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138671
Gene: ENSMUSG00000069601
AA Change: R921K

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1065 1074 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1114 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183148
AA Change: R1749K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138770
Gene: ENSMUSG00000069601
AA Change: R1749K

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1747 1767 N/A INTRINSIC
low complexity region 1893 1902 N/A INTRINSIC
low complexity region 1904 1916 N/A INTRINSIC
low complexity region 1942 1954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183169
AA Change: R1553K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138348
Gene: ENSMUSG00000069601
AA Change: R1553K

DomainStartEndE-ValueType
ANK 56 85 1.01e-5 SMART
ANK 89 118 1.66e-6 SMART
ANK 122 151 1.1e-6 SMART
ANK 155 183 6.51e0 SMART
ANK 184 213 2.6e1 SMART
ANK 217 246 1.31e-4 SMART
ANK 250 279 5.88e-7 SMART
ANK 283 312 3.23e-4 SMART
ANK 316 345 8.07e-5 SMART
ANK 349 378 1.53e-5 SMART
ANK 382 411 3.88e-7 SMART
ANK 415 444 1.99e-4 SMART
ANK 448 477 9.41e-6 SMART
ANK 481 510 1.14e-4 SMART
ANK 514 543 2.94e-7 SMART
ANK 547 576 3.33e-6 SMART
ANK 580 609 4.56e-4 SMART
ANK 613 642 8.19e-6 SMART
ANK 646 675 5.24e-4 SMART
ANK 679 708 6.46e-4 SMART
ANK 712 741 6.21e-6 SMART
ANK 745 774 1.43e-5 SMART
low complexity region 802 813 N/A INTRINSIC
ZU5 943 1047 2.27e-58 SMART
DEATH 1416 1510 7.66e-33 SMART
low complexity region 1551 1571 N/A INTRINSIC
low complexity region 1715 1724 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1764 1776 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183261
AA Change: R921K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138095
Gene: ENSMUSG00000069601
AA Change: R921K

DomainStartEndE-ValueType
ZU5 115 219 2.27e-58 SMART
DEATH 588 682 7.66e-33 SMART
low complexity region 919 939 N/A INTRINSIC
low complexity region 1082 1091 N/A INTRINSIC
low complexity region 1093 1105 N/A INTRINSIC
low complexity region 1131 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185582
SMART Domains Protein: ENSMUSP00000140724
Gene: ENSMUSG00000069601

DomainStartEndE-ValueType
low complexity region 66 94 N/A INTRINSIC
Pfam:Death 138 178 7.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186247
Predicted Effect unknown
Transcript: ENSMUST00000218680
AA Change: R1598K
Meta Mutation Damage Score 0.0654 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the ankyrin protein family. Ankyrins link integral membrane proteins to the spectrin-based cytoskeleton. Ankyrin family members share a protein structure which includes three independently folded domains: the N-terminal ankyrin repeat domain, the central spectrin-binding domain, and the C-terminal rod domain. This ankyrin functions as the major ankyrin in the kidney and may play a role in the polarized distribution of many integral membrane proteins to specific subcellular sites. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a mutation that selectively ablates gene expression in brain exhibit progressive ataxia, tremors, and a substantially reduced cerebellum deficient in Purkinje cells. Mutants are poor breeders and die by 4-6 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Ank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ank3 APN 10 69982205 splice site probably benign
IGL00578:Ank3 APN 10 70002394 missense possibly damaging 0.95
IGL00851:Ank3 APN 10 69874833 missense probably damaging 0.99
IGL01067:Ank3 APN 10 69850196 missense probably damaging 1.00
IGL01483:Ank3 APN 10 69874809 missense probably damaging 1.00
IGL01549:Ank3 APN 10 69932420 missense probably damaging 1.00
IGL01576:Ank3 APN 10 69980291 missense probably damaging 1.00
IGL01601:Ank3 APN 10 70004725 missense possibly damaging 0.87
IGL02047:Ank3 APN 10 69892494 missense possibly damaging 0.94
IGL02088:Ank3 APN 10 69999373 missense probably damaging 1.00
IGL02159:Ank3 APN 10 69808892 missense probably damaging 1.00
IGL02249:Ank3 APN 10 69882370 missense probably damaging 1.00
IGL02942:Ank3 APN 10 69973877 missense probably damaging 1.00
IGL02979:Ank3 APN 10 70002099 missense probably benign 0.01
IGL03379:Ank3 APN 10 69973772 missense probably damaging 1.00
PIT4495001:Ank3 UTSW 10 69993072 missense
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0011:Ank3 UTSW 10 69979451 splice site probably benign
R0172:Ank3 UTSW 10 69976058 missense probably damaging 1.00
R0315:Ank3 UTSW 10 70002517 missense probably damaging 0.98
R0480:Ank3 UTSW 10 69879926 missense probably damaging 0.96
R0485:Ank3 UTSW 10 69882544 missense possibly damaging 0.89
R0511:Ank3 UTSW 10 69882368 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1148:Ank3 UTSW 10 69882539 missense probably damaging 1.00
R1165:Ank3 UTSW 10 69898302 missense possibly damaging 0.90
R1186:Ank3 UTSW 10 69867460 missense probably damaging 1.00
R1257:Ank3 UTSW 10 69874835 nonsense probably null
R1300:Ank3 UTSW 10 70004665 missense probably benign 0.03
R1391:Ank3 UTSW 10 69534280 missense possibly damaging 0.96
R1549:Ank3 UTSW 10 70001982 missense probably benign 0.18
R1586:Ank3 UTSW 10 69877878 missense probably damaging 0.98
R1619:Ank3 UTSW 10 69879975 missense probably damaging 1.00
R1643:Ank3 UTSW 10 69884802 missense probably benign 0.00
R1874:Ank3 UTSW 10 69898083 missense probably damaging 1.00
R1884:Ank3 UTSW 10 70015592 missense possibly damaging 0.53
R1901:Ank3 UTSW 10 69822337 missense probably damaging 1.00
R1986:Ank3 UTSW 10 69867428 missense probably damaging 1.00
R2051:Ank3 UTSW 10 69898090 missense probably damaging 0.97
R2273:Ank3 UTSW 10 69950942 splice site probably null
R2274:Ank3 UTSW 10 69950942 splice site probably null
R2421:Ank3 UTSW 10 69982204 splice site probably benign
R2434:Ank3 UTSW 10 70002118 missense probably damaging 1.00
R2969:Ank3 UTSW 10 69994395 missense probably damaging 1.00
R3426:Ank3 UTSW 10 69706894 missense probably benign
R3885:Ank3 UTSW 10 69899036 missense probably damaging 1.00
R3936:Ank3 UTSW 10 69879989 nonsense probably null
R4258:Ank3 UTSW 10 70004762 missense probably benign 0.33
R4320:Ank3 UTSW 10 69904246 missense possibly damaging 0.70
R4434:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4435:Ank3 UTSW 10 69987070 missense probably damaging 0.99
R4486:Ank3 UTSW 10 70001974 missense possibly damaging 0.86
R4489:Ank3 UTSW 10 69898256 missense probably damaging 1.00
R4492:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R4508:Ank3 UTSW 10 69892370 missense probably damaging 1.00
R4561:Ank3 UTSW 10 70002018 missense probably damaging 0.99
R4724:Ank3 UTSW 10 69706858 missense probably benign
R4751:Ank3 UTSW 10 69986206 missense probably benign 0.19
R4790:Ank3 UTSW 10 69988151 nonsense probably null
R4795:Ank3 UTSW 10 69858265 missense probably benign 0.36
R4921:Ank3 UTSW 10 70002109 missense probably damaging 1.00
R4932:Ank3 UTSW 10 69898223 splice site probably null
R4935:Ank3 UTSW 10 69976203 missense probably damaging 0.99
R4946:Ank3 UTSW 10 69898117 missense probably damaging 1.00
R5174:Ank3 UTSW 10 69892379 missense probably damaging 0.99
R5208:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5248:Ank3 UTSW 10 69987108 missense probably benign 0.00
R5255:Ank3 UTSW 10 69885200 missense probably damaging 1.00
R5307:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5308:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5373:Ank3 UTSW 10 69953476 splice site probably null
R5374:Ank3 UTSW 10 69953476 splice site probably null
R5502:Ank3 UTSW 10 69920461 missense probably benign 0.12
R5508:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5509:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5510:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5538:Ank3 UTSW 10 69987427 missense probably damaging 1.00
R5664:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5665:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R5682:Ank3 UTSW 10 69893517 missense probably damaging 1.00
R5834:Ank3 UTSW 10 69822257 missense probably damaging 1.00
R5881:Ank3 UTSW 10 69986830 missense probably benign 0.31
R5914:Ank3 UTSW 10 69992944 intron probably benign
R5940:Ank3 UTSW 10 69920486 missense probably benign 0.00
R5952:Ank3 UTSW 10 69986463 missense probably benign 0.07
R5963:Ank3 UTSW 10 69987226 nonsense probably null
R6076:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6077:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6081:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6092:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6118:Ank3 UTSW 10 69994401 missense probably damaging 0.98
R6135:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6175:Ank3 UTSW 10 69927727 missense probably damaging 1.00
R6248:Ank3 UTSW 10 69973850 missense probably benign 0.10
R6249:Ank3 UTSW 10 69823076 critical splice acceptor site probably null
R6273:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6274:Ank3 UTSW 10 70002565 missense possibly damaging 0.91
R6290:Ank3 UTSW 10 69991368 intron probably benign
R6298:Ank3 UTSW 10 69850176 missense probably damaging 1.00
R6349:Ank3 UTSW 10 69979439 missense probably damaging 1.00
R6366:Ank3 UTSW 10 69999358 missense probably damaging 1.00
R6371:Ank3 UTSW 10 69808879 missense probably damaging 1.00
R6459:Ank3 UTSW 10 69991747 intron probably benign
R6489:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6491:Ank3 UTSW 10 69991629 missense probably benign 0.00
R6499:Ank3 UTSW 10 69991744 intron probably benign
R6520:Ank3 UTSW 10 69988387 missense probably damaging 1.00
R6521:Ank3 UTSW 10 69992766 intron probably benign
R6535:Ank3 UTSW 10 69877854 missense probably damaging 1.00
R6548:Ank3 UTSW 10 69892410 missense probably damaging 1.00
R6587:Ank3 UTSW 10 69990152 intron probably benign
R6624:Ank3 UTSW 10 69904468 missense possibly damaging 0.66
R6722:Ank3 UTSW 10 69990244 intron probably benign
R6729:Ank3 UTSW 10 69808925 missense probably damaging 1.00
R6731:Ank3 UTSW 10 70014028 missense possibly damaging 0.70
R6742:Ank3 UTSW 10 69991582 intron probably benign
R6788:Ank3 UTSW 10 70004723 missense probably damaging 1.00
R6846:Ank3 UTSW 10 69824349 missense probably damaging 1.00
R6933:Ank3 UTSW 10 69904212 missense probably damaging 1.00
R7034:Ank3 UTSW 10 69999379 missense probably damaging 1.00
R7036:Ank3 UTSW 10 69999379 missense probably damaging 1.00
R7132:Ank3 UTSW 10 69989914 missense
R7171:Ank3 UTSW 10 69992481 missense
R7241:Ank3 UTSW 10 69706814 start codon destroyed probably null 0.11
R7386:Ank3 UTSW 10 69822249 missense unknown
R7445:Ank3 UTSW 10 69992124 missense
R7452:Ank3 UTSW 10 69899051 missense possibly damaging 0.53
R7492:Ank3 UTSW 10 69882527 missense unknown
R7494:Ank3 UTSW 10 69988926 missense
R7512:Ank3 UTSW 10 69990861 missense
R7543:Ank3 UTSW 10 69951016 missense possibly damaging 0.96
R7577:Ank3 UTSW 10 69992572 missense
R7610:Ank3 UTSW 10 69986422 missense
R7673:Ank3 UTSW 10 69990501 missense
R7682:Ank3 UTSW 10 69988235 missense possibly damaging 0.53
R7814:Ank3 UTSW 10 69986904 missense
R7835:Ank3 UTSW 10 69987727 missense
R7843:Ank3 UTSW 10 69986958 missense probably benign 0.01
R7891:Ank3 UTSW 10 69988309 missense probably damaging 1.00
R8175:Ank3 UTSW 10 69893509 missense unknown
R8210:Ank3 UTSW 10 69976095 missense possibly damaging 0.72
R8211:Ank3 UTSW 10 69867398 missense unknown
R8299:Ank3 UTSW 10 69976151 missense probably damaging 0.98
Z1176:Ank3 UTSW 10 69932474 missense possibly damaging 0.96
Z1176:Ank3 UTSW 10 69951010 missense possibly damaging 0.85
Z1176:Ank3 UTSW 10 69991215 missense
Predicted Primers PCR Primer
(F):5'- AGGAAAATCTGGTCCTGATGAG -3'
(R):5'- GGGATTATAGCACACATAACCAATC -3'

Posted On2017-07-14