Mutagenetix > Incidental Mutations

Incidental Mutation 'R6075:Zfyve26'

482712

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, LOC380767, 9330197E15Rik

MMRRC Submission

044236-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6075 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

79232346-79296304 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79293854 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 82 (V82A)

Ref Sequence

ENSEMBL: ENSMUSP00000151280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000079533] [ENSMUST00000171210] [ENSMUST00000218039] [ENSMUST00000218377]

Predicted Effect

probably benign
Transcript: ENSMUST00000021547
AA Change: V82A

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440
AA Change: V82A

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079533

SMART Domains

Protein: ENSMUSP00000078490
Gene: ENSMUSG00000059060

Domain	Start	End	E-Value	Type
Pfam:Rad51	61	256	3.1e-32	PFAM
Pfam:AAA_25	68	249	1.1e-15	PFAM
Pfam:KaiC	83	240	1.2e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171210

SMART Domains

Protein: ENSMUSP00000128357
Gene: ENSMUSG00000059060

Domain	Start	End	E-Value	Type
Pfam:Rad51	61	256	3e-33	PFAM
Pfam:AAA_25	68	241	2.8e-16	PFAM
Pfam:KaiC	83	241	3.6e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000218039

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218377
AA Change: V82A

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218510

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219571

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219842

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Areg	A	T	5: 91,143,597	K133M	probably damaging	Het
Atxn2l	A	T	7: 126,492,517	D1076E	possibly damaging	Het
Barhl1	T	C	2: 28,915,219	Y154C	probably damaging	Het
BC048507	A	G	13: 67,863,704	T67A	probably benign	Het
BC055324	T	C	1: 163,978,087	Y316C	probably damaging	Het
Cacna1g	T	A	11: 94,416,665	I1746F	probably damaging	Het
Ccdc34	T	C	2: 110,044,235	I313T	possibly damaging	Het
Cma1	T	A	14: 55,942,314	I138F	probably damaging	Het
Col5a2	A	G	1: 45,502,848	S23P	unknown	Het
Csmd2	C	A	4: 128,486,865	S2071R	probably benign	Het
Cyp2j11	T	G	4: 96,345,085	N125H	probably benign	Het
Dchs2	A	G	3: 83,355,061	R2879G	possibly damaging	Het
Dnah11	A	T	12: 118,104,851	C1591S	probably damaging	Het
Dock9	C	T	14: 121,545,973	R2038H	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fbxo21	G	A	5: 117,988,883	R233H	probably damaging	Het
Gm6526	A	G	14: 43,748,874	I86V	probably damaging	Het
Gpr107	T	A	2: 31,152,372	V5E	probably benign	Het
Hat1	A	T	2: 71,410,241	D93V	probably benign	Het
Kctd21	T	A	7: 97,347,407	L29Q	probably damaging	Het
Kl	C	G	5: 150,953,001	F95L	probably damaging	Het
Lsamp	A	G	16: 42,134,425	K229E	probably benign	Het
Mcm5	A	G	8: 75,114,197	D210G	probably damaging	Het
Mdn1	T	C	4: 32,689,581	V930A	possibly damaging	Het
Megf6	T	A	4: 154,262,599	C652*	probably null	Het
Nae1	A	T	8: 104,524,369	L196H	possibly damaging	Het
Ncor1	G	T	11: 62,317,849	D156E	probably damaging	Het
Nop14	A	T	5: 34,659,891	V52E	probably damaging	Het
Nova2	G	A	7: 18,957,869	A244T	unknown	Het
Parp14	A	T	16: 35,857,019	C860S	probably damaging	Het
Ptpn4	T	C	1: 119,765,136	Y161C	probably damaging	Het
Ptpn9	T	A	9: 57,061,146	M590K	probably benign	Het
Ptprq	A	G	10: 107,525,760	I2130T	probably damaging	Het
Pudp	C	A	18: 50,568,228	G145W	probably damaging	Het
Pxk	A	G	14: 8,150,964	K423R	probably benign	Het
Ryr1	A	G	7: 29,087,438	S1584P	probably damaging	Het
Scap	G	A	9: 110,378,777	R518H	probably damaging	Het
Slc5a12	T	C	2: 110,616,747	L200P	probably damaging	Het
Sntg1	T	A	1: 8,679,114	*72Y	probably null	Het
Speer4f1	A	C	5: 17,479,484	Q170P	possibly damaging	Het
Taar7d	A	C	10: 24,027,660	I147L	probably benign	Het
Tet2	T	C	3: 133,471,435	K1284E	possibly damaging	Het
Trpm2	A	C	10: 77,935,043		probably null	Het
Washc2	T	A	6: 116,227,366	S412T	probably benign	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79249460	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79280900	missense	probably benign
IGL01148:Zfyve26	APN	12	79260870	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79252183	splice site	probably null
IGL01472:Zfyve26	APN	12	79276343	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79244373	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79287851	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79261574	splice site	probably null
IGL01689:Zfyve26	APN	12	79284053	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79287444	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79244400	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79276395	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79268847	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79280080	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79239020	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79263870	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79261791	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79295564	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79284072	nonsense	probably null
IGL02799:Zfyve26	UTSW	12	79273310	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79276281	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79244484	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79246222	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79268728	missense	possibly damaging	0.96
R0718:Zfyve26	UTSW	12	79265802	splice site	probably benign
R0738:Zfyve26	UTSW	12	79295534	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79273598	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79272127	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79263949	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79274920	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79282817	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79252163	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79252151	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79287761	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79238944	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79278463	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79269049	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79286258	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79264351	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79239970	nonsense	probably null
R1982:Zfyve26	UTSW	12	79255243	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79284032	splice site	probably null
R2071:Zfyve26	UTSW	12	79287446	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79246052	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79246087	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79275040	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79284116	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79282799	splice site	probably null
R3084:Zfyve26	UTSW	12	79265683	splice site	probably benign
R3086:Zfyve26	UTSW	12	79265683	splice site	probably benign
R4626:Zfyve26	UTSW	12	79269070	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79244396	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79249695	splice site	probably null
R4926:Zfyve26	UTSW	12	79275011	missense	probably benign
R4990:Zfyve26	UTSW	12	79287833	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79280385	nonsense	probably null
R5029:Zfyve26	UTSW	12	79286323	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79255361	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79280058	nonsense	probably null
R5252:Zfyve26	UTSW	12	79268982	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79270850	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79246521	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79239924	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79273373	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79264357	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79287737	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79266537	missense	probably benign	0.30
R6184:Zfyve26	UTSW	12	79268727	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79249599	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79282984	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79240002	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79238335	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79266449	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79284152	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79279114	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79280405	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79268408	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79246171	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79278372	splice site	probably null
R7299:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79251168	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79240054	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79287807	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79268676	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79290957	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79268635	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79280355	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79255324	missense	probably damaging	1.00
R8141:Zfyve26	UTSW	12	79268557	missense	possibly damaging	0.79
R8190:Zfyve26	UTSW	12	79280836	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79260831	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79255263	missense	probably damaging	1.00
R8500:Zfyve26	UTSW	12	79287680
RF010:Zfyve26	UTSW	12	79255338	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79239005	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79268533	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79287375	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GTGGACAGCATCACTCCAAATG -3'
(R):5'- CCAGTTCAGCTCTAAAGTGGGC -3'

Posted On

2017-07-14