Incidental Mutation 'R6075:Pxk'
ID482715
Institutional Source Beutler Lab
Gene Symbol Pxk
Ensembl Gene ENSMUSG00000033885
Gene NamePX domain containing serine/threonine kinase
SynonymsMONaKA, D14Ertd813e, C230080L11Rik
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location8098211-8165117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8150964 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 423 (K423R)
Ref Sequence ENSEMBL: ENSMUSP00000152987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036682] [ENSMUST00000112689] [ENSMUST00000225653]
Predicted Effect probably benign
Transcript: ENSMUST00000036682
AA Change: K423R

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035265
Gene: ENSMUSG00000033885
AA Change: K423R

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase 183 441 1.1e-9 PFAM
Pfam:Pkinase_Tyr 185 309 2.5e-7 PFAM
low complexity region 483 536 N/A INTRINSIC
Pfam:WH2 549 577 1.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112689
AA Change: K423R

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000108309
Gene: ENSMUSG00000033885
AA Change: K423R

DomainStartEndE-ValueType
PX 17 122 1.62e-16 SMART
Pfam:Pkinase_Tyr 185 309 3e-7 PFAM
Pfam:Pkinase 185 441 1.4e-10 PFAM
low complexity region 483 509 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000225653
AA Change: K423R

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phox (PX) domain-containing protein which may be involved in synaptic transmission and the ligand-induced internalization and degradation of epidermal growth factors. Variations in this gene may be associated with susceptibility to systemic lupus erythematosus (SLE). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Pxk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Pxk APN 14 8130754 missense probably damaging 1.00
IGL01865:Pxk APN 14 8136923 missense possibly damaging 0.94
IGL03171:Pxk APN 14 8151014 splice site probably benign
PIT4131001:Pxk UTSW 14 8152130 missense probably benign 0.01
R0799:Pxk UTSW 14 8148123 missense probably benign 0.02
R1367:Pxk UTSW 14 8150915 splice site probably null
R1546:Pxk UTSW 14 8164091 missense probably damaging 1.00
R1800:Pxk UTSW 14 8151507 nonsense probably null
R1827:Pxk UTSW 14 8151507 nonsense probably null
R1828:Pxk UTSW 14 8151507 nonsense probably null
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1888:Pxk UTSW 14 8151540 missense probably damaging 1.00
R1892:Pxk UTSW 14 8151507 nonsense probably null
R1893:Pxk UTSW 14 8151507 nonsense probably null
R3766:Pxk UTSW 14 8136863 splice site probably benign
R4807:Pxk UTSW 14 8144133 missense probably damaging 1.00
R4816:Pxk UTSW 14 8136893 missense probably damaging 1.00
R4833:Pxk UTSW 14 8130653 missense probably damaging 1.00
R4974:Pxk UTSW 14 8140734 missense probably damaging 1.00
R5400:Pxk UTSW 14 8136911 missense probably benign 0.45
R6144:Pxk UTSW 14 8138011 missense probably damaging 0.99
R6211:Pxk UTSW 14 8163952 missense probably damaging 0.96
R6997:Pxk UTSW 14 8122371 missense probably benign 0.29
R7266:Pxk UTSW 14 8146220 missense probably benign 0.00
R7363:Pxk UTSW 14 8152118 missense probably benign 0.01
Z1176:Pxk UTSW 14 8146271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGTCTGAAAGTGCTGGCAAG -3'
(R):5'- GGACCTGTGAGATGCTGTTC -3'

Posted On2017-07-14