Incidental Mutation 'R6075:Lsamp'
ID482720
Institutional Source Beutler Lab
Gene Symbol Lsamp
Ensembl Gene ENSMUSG00000061080
Gene Namelimbic system-associated membrane protein
SynonymsLamp, D930023J12Rik, Lam, B130007O04Rik
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location39984361-42181679 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42134425 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 229 (K229E)
Ref Sequence ENSEMBL: ENSMUSP00000139667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078873] [ENSMUST00000099761] [ENSMUST00000187695]
Predicted Effect probably benign
Transcript: ENSMUST00000078873
AA Change: K212E

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077913
Gene: ENSMUSG00000061080
AA Change: K212E

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 38 129 1.81e-10 SMART
IGc2 144 204 3.7e-16 SMART
IGc2 230 297 2.12e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099761
AA Change: K212E

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000097349
Gene: ENSMUSG00000061080
AA Change: K212E

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
IG 38 129 1.81e-10 SMART
IGc2 144 204 3.7e-16 SMART
IGc2 230 297 2.12e-16 SMART
transmembrane domain 313 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187695
AA Change: K229E

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000139667
Gene: ENSMUSG00000061080
AA Change: K229E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 55 146 7.6e-13 SMART
IGc2 161 221 1.5e-18 SMART
IGc2 247 314 8.6e-19 SMART
transmembrane domain 330 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin LAMP, OBCAM and neurotrimin (IgLON) family of proteins. The encoded preproprotein is proteolytically processed to generate a neuronal surface glycoprotein. This protein may act as a selective homophilic adhesion molecule during axon guidance and neuronal growth in the developing limbic system. The encoded protein may also function as a tumor suppressor and may play a role in neuropsychiatric disorders. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for mutations in this gene are hyperresponsive to novel environments. Mice homozygous for another knock-out allele exhibit reduced barbering, whisker trimming, anxiety, dominance, and aggression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Lsamp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Lsamp APN 16 42144012 nonsense probably null
IGL02869:Lsamp APN 16 42144715 missense probably benign 0.00
R0930:Lsamp UTSW 16 41888964 missense probably benign 0.25
R1147:Lsamp UTSW 16 42174136 splice site probably benign
R1170:Lsamp UTSW 16 42151229 intron probably benign
R1649:Lsamp UTSW 16 41955298 missense probably benign 0.00
R1656:Lsamp UTSW 16 41955319 missense probably damaging 1.00
R1976:Lsamp UTSW 16 41889067 missense probably damaging 0.99
R3613:Lsamp UTSW 16 41955323 missense probably benign 0.03
R3732:Lsamp UTSW 16 42144572 missense probably damaging 1.00
R3734:Lsamp UTSW 16 42144770 missense probably benign
R3838:Lsamp UTSW 16 42134312 missense possibly damaging 0.54
R3890:Lsamp UTSW 16 39984692 missense probably benign 0.01
R3891:Lsamp UTSW 16 39984692 missense probably benign 0.01
R4554:Lsamp UTSW 16 42144075 missense probably damaging 1.00
R4672:Lsamp UTSW 16 41955334 missense probably damaging 1.00
R5151:Lsamp UTSW 16 42134429 missense probably damaging 1.00
R5617:Lsamp UTSW 16 42134423 missense probably damaging 1.00
R6217:Lsamp UTSW 16 42134312 missense possibly damaging 0.54
R6477:Lsamp UTSW 16 42168165 intron probably benign
R6637:Lsamp UTSW 16 41533381 missense possibly damaging 0.86
X0024:Lsamp UTSW 16 42144558 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAGGGCCAAGTCAGCATTG -3'
(R):5'- AAATTCAAAGGCCAAGTCTCG -3'

Posted On2017-07-14