Incidental Mutation 'R6075:Pudp'
ID482721
Institutional Source Beutler Lab
Gene Symbol Pudp
Ensembl Gene ENSMUSG00000048875
Gene Namepseudouridine 5-phosphatase
SynonymsHdhd1a, GS1, 1700121L12Rik
MMRRC Submission 044236-MU
Accession Numbers

Genbank: NM_026108.3

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location50567656-50568699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 50568228 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 145 (G145W)
Ref Sequence ENSEMBL: ENSMUSP00000057378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056460]
Predicted Effect probably damaging
Transcript: ENSMUST00000056460
AA Change: G145W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057378
Gene: ENSMUSG00000048875
AA Change: G145W

DomainStartEndE-ValueType
Pfam:Hydrolase 13 193 3.2e-15 PFAM
Pfam:HAD_2 16 199 5.6e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the haloacid dehalogenase-like (HAD) hydrolase superfamily. The encoded protein has no known biological function. This gene has a pseudogene on chromosome 1. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2010]
Allele List at MGI

 All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Pudp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Pudp APN 18 50568278 missense probably damaging 1.00
IGL02735:Pudp APN 18 50568332 missense probably benign 0.10
IGL03178:Pudp APN 18 50568401 missense probably benign 0.23
F5426:Pudp UTSW 18 50568541 missense probably benign 0.00
R1914:Pudp UTSW 18 50568207 missense probably benign 0.06
R1915:Pudp UTSW 18 50568207 missense probably benign 0.06
R2338:Pudp UTSW 18 50568575 missense probably benign 0.01
R3856:Pudp UTSW 18 50568053 missense probably benign 0.34
R4067:Pudp UTSW 18 50568258 missense probably benign 0.06
R4649:Pudp UTSW 18 50568188 missense probably damaging 1.00
R4783:Pudp UTSW 18 50568065 missense probably damaging 1.00
R4784:Pudp UTSW 18 50568065 missense probably damaging 1.00
R4785:Pudp UTSW 18 50568065 missense probably damaging 1.00
R4936:Pudp UTSW 18 50568468 missense probably benign 0.00
R6430:Pudp UTSW 18 50568236 missense probably benign 0.33
R7285:Pudp UTSW 18 50568216 missense possibly damaging 0.94
R7592:Pudp UTSW 18 50567982 missense probably damaging 1.00
R8012:Pudp UTSW 18 50568239 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTTGAAGTCGTGGAGGGAAC -3'
(R):5'- AGCTGCAGATGGTGTTGCAC -3'

Posted On2017-07-14