Incidental Mutation 'R6075:Afg3l2'
ID482722
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene NameAFG3-like AAA ATPase 2
Synonyms2310036I02Rik, Emv66, par
MMRRC Submission 044236-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6075 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location67404767-67449166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67421259 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 458 (L458M)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Areg A T 5: 91,143,597 K133M probably damaging Het
Atxn2l A T 7: 126,492,517 D1076E possibly damaging Het
Barhl1 T C 2: 28,915,219 Y154C probably damaging Het
BC048507 A G 13: 67,863,704 T67A probably benign Het
BC055324 T C 1: 163,978,087 Y316C probably damaging Het
Cacna1g T A 11: 94,416,665 I1746F probably damaging Het
Ccdc34 T C 2: 110,044,235 I313T possibly damaging Het
Cma1 T A 14: 55,942,314 I138F probably damaging Het
Col5a2 A G 1: 45,502,848 S23P unknown Het
Csmd2 C A 4: 128,486,865 S2071R probably benign Het
Cyp2j11 T G 4: 96,345,085 N125H probably benign Het
Dchs2 A G 3: 83,355,061 R2879G possibly damaging Het
Dnah11 A T 12: 118,104,851 C1591S probably damaging Het
Dock9 C T 14: 121,545,973 R2038H probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fbxo21 G A 5: 117,988,883 R233H probably damaging Het
Gm6526 A G 14: 43,748,874 I86V probably damaging Het
Gpr107 T A 2: 31,152,372 V5E probably benign Het
Hat1 A T 2: 71,410,241 D93V probably benign Het
Kctd21 T A 7: 97,347,407 L29Q probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Lsamp A G 16: 42,134,425 K229E probably benign Het
Mcm5 A G 8: 75,114,197 D210G probably damaging Het
Mdn1 T C 4: 32,689,581 V930A possibly damaging Het
Megf6 T A 4: 154,262,599 C652* probably null Het
Nae1 A T 8: 104,524,369 L196H possibly damaging Het
Ncor1 G T 11: 62,317,849 D156E probably damaging Het
Nop14 A T 5: 34,659,891 V52E probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Parp14 A T 16: 35,857,019 C860S probably damaging Het
Ptpn4 T C 1: 119,765,136 Y161C probably damaging Het
Ptpn9 T A 9: 57,061,146 M590K probably benign Het
Ptprq A G 10: 107,525,760 I2130T probably damaging Het
Pudp C A 18: 50,568,228 G145W probably damaging Het
Pxk A G 14: 8,150,964 K423R probably benign Het
Ryr1 A G 7: 29,087,438 S1584P probably damaging Het
Scap G A 9: 110,378,777 R518H probably damaging Het
Slc5a12 T C 2: 110,616,747 L200P probably damaging Het
Sntg1 T A 1: 8,679,114 *72Y probably null Het
Speer4f1 A C 5: 17,479,484 Q170P possibly damaging Het
Taar7d A C 10: 24,027,660 I147L probably benign Het
Tet2 T C 3: 133,471,435 K1284E possibly damaging Het
Trpm2 A C 10: 77,935,043 probably null Het
Washc2 T A 6: 116,227,366 S412T probably benign Het
Zfyve26 A G 12: 79,293,854 V82A possibly damaging Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67431653 critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67442810 missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67405418 nonsense probably null
IGL01814:Afg3l2 APN 18 67405474 missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67414148 missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67429040 missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67425945 missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67407320 missense probably benign
IGL03392:Afg3l2 APN 18 67414069 splice site probably benign
radicle UTSW 18 67422953 missense probably damaging 1.00
rootlet UTSW 18 67421259 missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67423086 missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67431766 missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67415557 missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67421227 missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67422977 missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67405427 missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67407423 missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67415573 nonsense probably null
R1838:Afg3l2 UTSW 18 67414172 missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67431772 missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67422956 missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67440222 missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67440207 missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67442355 nonsense probably null
R5696:Afg3l2 UTSW 18 67407459 missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67440199 missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67440443 missense probably null 0.12
R5972:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67429070 missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6081:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67409528 missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67421259 missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67421276 missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67422953 missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67431707 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCACTGTCCAGCTTCAATGG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Posted On2017-07-14