Incidental Mutation 'R6076:Jchain'
ID482737
Institutional Source Beutler Lab
Gene Symbol Jchain
Ensembl Gene ENSMUSG00000067149
Gene Nameimmunoglobulin joining chain
SynonymsJ chain, 9530090F24Rik, Igj, Jch
MMRRC Submission 044237-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6076 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location88519809-88527891 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88527772 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 3 (T3N)
Ref Sequence ENSEMBL: ENSMUSP00000084259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087033]
Predicted Effect probably benign
Transcript: ENSMUST00000087033
AA Change: T3N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084259
Gene: ENSMUSG00000067149
AA Change: T3N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_J_chain 23 159 6.3e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164073
SMART Domains Protein: ENSMUSP00000132955
Gene: ENSMUSG00000067149

DomainStartEndE-ValueType
Pfam:Ig_J_chain 1 119 1.3e-72 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show increased IgA level and alterations in IgA transport and in susceptibility to viral and parasitic infections. Homozygotes for another null allele show increased IgA level, decreased IgM level, reduced numbers of IgM plasma cells, and impaired IgM immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp6v0a1 T A 11: 101,055,060 I723N probably damaging Het
C530025M09Rik T C 2: 149,830,750 probably benign Het
Cdkn1a A G 17: 29,099,358 K149E probably damaging Het
Cep70 T A 9: 99,298,505 I571N probably damaging Het
Col9a1 A T 1: 24,195,376 probably benign Het
Csde1 G A 3: 103,041,229 D132N possibly damaging Het
Dlk1 A G 12: 109,459,969 Q256R probably damaging Het
Epha6 A T 16: 60,205,710 D456E probably damaging Het
Ephx2 A G 14: 66,092,848 V354A probably damaging Het
Fpr-rs4 A G 17: 18,022,055 N108S probably damaging Het
Gimap1 C T 6: 48,742,587 Q116* probably null Het
Gm10784 T C 13: 49,945,274 noncoding transcript Het
Grid2ip G C 5: 143,387,375 S736T probably benign Het
Hic1 T C 11: 75,167,328 D245G probably damaging Het
Hpcal4 C A 4: 123,190,721 Q148K probably benign Het
Hspa14 C T 2: 3,511,072 S55N probably benign Het
Hspa1b G A 17: 34,957,497 T504I probably damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Kndc1 A G 7: 139,902,038 T115A probably damaging Het
Lrp8 G T 4: 107,847,459 R292L possibly damaging Het
Lrrc15 T A 16: 30,272,988 D511V probably benign Het
Mapk8 A G 14: 33,390,293 C213R probably damaging Het
Mcph1 C T 8: 18,631,999 P384L probably benign Het
Mrps7 T C 11: 115,604,887 S84P probably damaging Het
Nceh1 A C 3: 27,279,195 I147L probably benign Het
Noxa1 A T 2: 25,085,809 I409N probably damaging Het
Olfr406 T C 11: 74,270,262 I291T probably damaging Het
Pkd1 G A 17: 24,581,030 G2975R probably benign Het
Ppip5k1 T C 2: 121,337,110 D17G probably null Het
Prex2 T A 1: 11,185,950 Y1182N probably benign Het
Rasa2 T C 9: 96,545,646 N722S probably benign Het
Rcc1l A G 5: 134,169,328 V155A possibly damaging Het
Rest A G 5: 77,282,974 E1080G unknown Het
Sacs A T 14: 61,204,536 K1344* probably null Het
Sec16a C T 2: 26,423,942 E1884K probably damaging Het
Secisbp2 C A 13: 51,679,777 T651K probably damaging Het
Sema3e A G 5: 14,241,086 D620G probably benign Het
Slc6a17 A G 3: 107,472,071 S553P possibly damaging Het
Smpd5 C A 15: 76,294,892 N153K probably damaging Het
Tex33 T C 15: 78,386,227 R114G possibly damaging Het
Ube2d4 T A 15: 58,847,143 noncoding transcript Het
Vps13c A G 9: 67,911,602 I1102V probably damaging Het
Wdr36 C A 18: 32,846,945 S241Y probably damaging Het
Wdr7 T A 18: 63,739,277 D427E probably damaging Het
Zfp945 G A 17: 22,851,458 P489L probably damaging Het
Other mutations in Jchain
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Jchain APN 5 88521524 missense probably damaging 1.00
R0403:Jchain UTSW 5 88521378 missense probably benign 0.01
R0718:Jchain UTSW 5 88526202 missense probably benign 0.00
R1470:Jchain UTSW 5 88526120 missense probably benign 0.21
R1470:Jchain UTSW 5 88526120 missense probably benign 0.21
R1987:Jchain UTSW 5 88521467 missense probably damaging 0.99
R3684:Jchain UTSW 5 88522539 missense probably damaging 1.00
R5010:Jchain UTSW 5 88522505 missense probably damaging 0.98
R5785:Jchain UTSW 5 88522517 missense probably benign 0.13
R6250:Jchain UTSW 5 88526175 missense probably benign 0.00
R6275:Jchain UTSW 5 88521353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTAGAAGGTAGCTAGCTGTCC -3'
(R):5'- ATGAGCCATCAAATCCCAGCTTTC -3'

Sequencing Primer
(F):5'- CTGTCCAGCTAGCCAGTAGAAG -3'
(R):5'- CGTAAGTATGAACCATGTGCGTC -3'
Posted On2017-07-14