Incidental Mutation 'R6076:Atp6v0a1'
ID482750
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene NameATPase, H+ transporting, lysosomal V0 subunit A1
SynonymsAtp6n1a, Vpp-1, Vpp1, V-ATPase a1, Atp6n1
MMRRC Submission 044237-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6076 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101009452-101063719 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101055060 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 723 (I723N)
Ref Sequence ENSEMBL: ENSMUSP00000131848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
Predicted Effect probably damaging
Transcript: ENSMUST00000044721
AA Change: I723N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: I723N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092663
AA Change: I717N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: I717N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103110
AA Change: I724N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: I724N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168757
AA Change: I723N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: I723N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
C530025M09Rik T C 2: 149,830,750 probably benign Het
Cdkn1a A G 17: 29,099,358 K149E probably damaging Het
Cep70 T A 9: 99,298,505 I571N probably damaging Het
Col9a1 A T 1: 24,195,376 probably benign Het
Csde1 G A 3: 103,041,229 D132N possibly damaging Het
Dlk1 A G 12: 109,459,969 Q256R probably damaging Het
Epha6 A T 16: 60,205,710 D456E probably damaging Het
Ephx2 A G 14: 66,092,848 V354A probably damaging Het
Fpr-rs4 A G 17: 18,022,055 N108S probably damaging Het
Gimap1 C T 6: 48,742,587 Q116* probably null Het
Gm10784 T C 13: 49,945,274 noncoding transcript Het
Grid2ip G C 5: 143,387,375 S736T probably benign Het
Hic1 T C 11: 75,167,328 D245G probably damaging Het
Hpcal4 C A 4: 123,190,721 Q148K probably benign Het
Hspa14 C T 2: 3,511,072 S55N probably benign Het
Hspa1b G A 17: 34,957,497 T504I probably damaging Het
Jchain G T 5: 88,527,772 T3N probably benign Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Kndc1 A G 7: 139,902,038 T115A probably damaging Het
Lrp8 G T 4: 107,847,459 R292L possibly damaging Het
Lrrc15 T A 16: 30,272,988 D511V probably benign Het
Mapk8 A G 14: 33,390,293 C213R probably damaging Het
Mcph1 C T 8: 18,631,999 P384L probably benign Het
Mrps7 T C 11: 115,604,887 S84P probably damaging Het
Nceh1 A C 3: 27,279,195 I147L probably benign Het
Noxa1 A T 2: 25,085,809 I409N probably damaging Het
Olfr406 T C 11: 74,270,262 I291T probably damaging Het
Pkd1 G A 17: 24,581,030 G2975R probably benign Het
Ppip5k1 T C 2: 121,337,110 D17G probably null Het
Prex2 T A 1: 11,185,950 Y1182N probably benign Het
Rasa2 T C 9: 96,545,646 N722S probably benign Het
Rcc1l A G 5: 134,169,328 V155A possibly damaging Het
Rest A G 5: 77,282,974 E1080G unknown Het
Sacs A T 14: 61,204,536 K1344* probably null Het
Sec16a C T 2: 26,423,942 E1884K probably damaging Het
Secisbp2 C A 13: 51,679,777 T651K probably damaging Het
Sema3e A G 5: 14,241,086 D620G probably benign Het
Slc6a17 A G 3: 107,472,071 S553P possibly damaging Het
Smpd5 C A 15: 76,294,892 N153K probably damaging Het
Tex33 T C 15: 78,386,227 R114G possibly damaging Het
Ube2d4 T A 15: 58,847,143 noncoding transcript Het
Vps13c A G 9: 67,911,602 I1102V probably damaging Het
Wdr36 C A 18: 32,846,945 S241Y probably damaging Het
Wdr7 T A 18: 63,739,277 D427E probably damaging Het
Zfp945 G A 17: 22,851,458 P489L probably damaging Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 101030505 critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 101048439 missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 101043802 missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 101039840 missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 101055518 missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 101038851 splice site probably null
R0193:Atp6v0a1 UTSW 11 101048482 missense possibly damaging 0.90
R0265:Atp6v0a1 UTSW 11 101048515 missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0973:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R0974:Atp6v0a1 UTSW 11 101055491 nonsense probably null
R1460:Atp6v0a1 UTSW 11 101033998 missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 101029204 missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 101055554 missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 101038786 missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 101026685 missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 101044598 missense probably benign
R2926:Atp6v0a1 UTSW 11 101043948 missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 101030420 missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 101055517 missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 101042950 missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 101020515 missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 101043044 missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 101055587 missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 101038807 missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 101029185 missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 101018574 missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 101039889 missense possibly damaging 0.91
R6889:Atp6v0a1 UTSW 11 101029183 missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 101027357 missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 101034042 missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 101043957 missense probably benign 0.08
X0023:Atp6v0a1 UTSW 11 101044597 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGGCCAGGAAGGATTTCTGG -3'
(R):5'- AGAACCATCATGTGTTTCTGTGC -3'

Sequencing Primer
(F):5'- GAAGTCGTTGCTGAAATCACC -3'
(R):5'- TTCTGTGCTGAGGAAGGCCC -3'
Posted On2017-07-14