Incidental Mutation 'R6076:Epha6'
ID 482762
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
MMRRC Submission 044237-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6076 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 60205710 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 456 (D456E)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068860
AA Change: D456E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: D456E

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp6v0a1 T A 11: 101,055,060 I723N probably damaging Het
C530025M09Rik T C 2: 149,830,750 probably benign Het
Cdkn1a A G 17: 29,099,358 K149E probably damaging Het
Cep70 T A 9: 99,298,505 I571N probably damaging Het
Col9a1 A T 1: 24,195,376 probably benign Het
Csde1 G A 3: 103,041,229 D132N possibly damaging Het
Dlk1 A G 12: 109,459,969 Q256R probably damaging Het
Ephx2 A G 14: 66,092,848 V354A probably damaging Het
Fpr-rs4 A G 17: 18,022,055 N108S probably damaging Het
Gimap1 C T 6: 48,742,587 Q116* probably null Het
Gm10784 T C 13: 49,945,274 noncoding transcript Het
Grid2ip G C 5: 143,387,375 S736T probably benign Het
Hic1 T C 11: 75,167,328 D245G probably damaging Het
Hpcal4 C A 4: 123,190,721 Q148K probably benign Het
Hspa14 C T 2: 3,511,072 S55N probably benign Het
Hspa1b G A 17: 34,957,497 T504I probably damaging Het
Jchain G T 5: 88,527,772 T3N probably benign Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Kndc1 A G 7: 139,902,038 T115A probably damaging Het
Lrp8 G T 4: 107,847,459 R292L possibly damaging Het
Lrrc15 T A 16: 30,272,988 D511V probably benign Het
Mapk8 A G 14: 33,390,293 C213R probably damaging Het
Mcph1 C T 8: 18,631,999 P384L probably benign Het
Mrps7 T C 11: 115,604,887 S84P probably damaging Het
Nceh1 A C 3: 27,279,195 I147L probably benign Het
Noxa1 A T 2: 25,085,809 I409N probably damaging Het
Olfr406 T C 11: 74,270,262 I291T probably damaging Het
Pkd1 G A 17: 24,581,030 G2975R probably benign Het
Ppip5k1 T C 2: 121,337,110 D17G probably null Het
Prex2 T A 1: 11,185,950 Y1182N probably benign Het
Rasa2 T C 9: 96,545,646 N722S probably benign Het
Rcc1l A G 5: 134,169,328 V155A possibly damaging Het
Rest A G 5: 77,282,974 E1080G unknown Het
Sacs A T 14: 61,204,536 K1344* probably null Het
Sec16a C T 2: 26,423,942 E1884K probably damaging Het
Secisbp2 C A 13: 51,679,777 T651K probably damaging Het
Sema3e A G 5: 14,241,086 D620G probably benign Het
Slc6a17 A G 3: 107,472,071 S553P possibly damaging Het
Smpd5 C A 15: 76,294,892 N153K probably damaging Het
Tex33 T C 15: 78,386,227 R114G possibly damaging Het
Ube2d4 T A 15: 58,847,143 noncoding transcript Het
Vps13c A G 9: 67,911,602 I1102V probably damaging Het
Wdr36 C A 18: 32,846,945 S241Y probably damaging Het
Wdr7 T A 18: 63,739,277 D427E probably damaging Het
Zfp945 G A 17: 22,851,458 P489L probably damaging Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4818:Epha6 UTSW 16 59654063 missense probably damaging 0.99
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAGAGATGCTCAACTCAG -3'
(R):5'- CACCATTAAAGTTTCCTCCTTAAGC -3'

Sequencing Primer
(F):5'- GGAGAGATGCTCAACTCAGAAACTC -3'
(R):5'- AAGTTTCCTCCTTAAGCTTCATTAG -3'
Posted On 2017-07-14