Incidental Mutation 'R6076:Fpr-rs4'
ID482763
Institutional Source Beutler Lab
Gene Symbol Fpr-rs4
Ensembl Gene ENSMUSG00000048062
Gene Nameformyl peptide receptor, related sequence 4
Synonyms
MMRRC Submission 044237-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R6076 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location18021733-18022704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18022055 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 108 (N108S)
Ref Sequence ENSEMBL: ENSMUSP00000093311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095651]
Predicted Effect probably damaging
Transcript: ENSMUST00000095651
AA Change: N108S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093311
Gene: ENSMUSG00000048062
AA Change: N108S

DomainStartEndE-ValueType
Pfam:7tm_1 43 297 4.9e-35 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Atp6v0a1 T A 11: 101,055,060 I723N probably damaging Het
C530025M09Rik T C 2: 149,830,750 probably benign Het
Cdkn1a A G 17: 29,099,358 K149E probably damaging Het
Cep70 T A 9: 99,298,505 I571N probably damaging Het
Col9a1 A T 1: 24,195,376 probably benign Het
Csde1 G A 3: 103,041,229 D132N possibly damaging Het
Dlk1 A G 12: 109,459,969 Q256R probably damaging Het
Epha6 A T 16: 60,205,710 D456E probably damaging Het
Ephx2 A G 14: 66,092,848 V354A probably damaging Het
Gimap1 C T 6: 48,742,587 Q116* probably null Het
Gm10784 T C 13: 49,945,274 noncoding transcript Het
Grid2ip G C 5: 143,387,375 S736T probably benign Het
Hic1 T C 11: 75,167,328 D245G probably damaging Het
Hpcal4 C A 4: 123,190,721 Q148K probably benign Het
Hspa14 C T 2: 3,511,072 S55N probably benign Het
Hspa1b G A 17: 34,957,497 T504I probably damaging Het
Jchain G T 5: 88,527,772 T3N probably benign Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Kndc1 A G 7: 139,902,038 T115A probably damaging Het
Lrp8 G T 4: 107,847,459 R292L possibly damaging Het
Lrrc15 T A 16: 30,272,988 D511V probably benign Het
Mapk8 A G 14: 33,390,293 C213R probably damaging Het
Mcph1 C T 8: 18,631,999 P384L probably benign Het
Mrps7 T C 11: 115,604,887 S84P probably damaging Het
Nceh1 A C 3: 27,279,195 I147L probably benign Het
Noxa1 A T 2: 25,085,809 I409N probably damaging Het
Olfr406 T C 11: 74,270,262 I291T probably damaging Het
Pkd1 G A 17: 24,581,030 G2975R probably benign Het
Ppip5k1 T C 2: 121,337,110 D17G probably null Het
Prex2 T A 1: 11,185,950 Y1182N probably benign Het
Rasa2 T C 9: 96,545,646 N722S probably benign Het
Rcc1l A G 5: 134,169,328 V155A possibly damaging Het
Rest A G 5: 77,282,974 E1080G unknown Het
Sacs A T 14: 61,204,536 K1344* probably null Het
Sec16a C T 2: 26,423,942 E1884K probably damaging Het
Secisbp2 C A 13: 51,679,777 T651K probably damaging Het
Sema3e A G 5: 14,241,086 D620G probably benign Het
Slc6a17 A G 3: 107,472,071 S553P possibly damaging Het
Smpd5 C A 15: 76,294,892 N153K probably damaging Het
Tex33 T C 15: 78,386,227 R114G possibly damaging Het
Ube2d4 T A 15: 58,847,143 noncoding transcript Het
Vps13c A G 9: 67,911,602 I1102V probably damaging Het
Wdr36 C A 18: 32,846,945 S241Y probably damaging Het
Wdr7 T A 18: 63,739,277 D427E probably damaging Het
Zfp945 G A 17: 22,851,458 P489L probably damaging Het
Other mutations in Fpr-rs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Fpr-rs4 APN 17 18021926 missense probably damaging 1.00
IGL01064:Fpr-rs4 APN 17 18022517 missense probably damaging 1.00
IGL01626:Fpr-rs4 APN 17 18022231 missense probably damaging 0.97
IGL02544:Fpr-rs4 APN 17 18022211 missense probably benign
IGL02837:Fpr-rs4 UTSW 17 18022251 missense probably benign 0.00
R0179:Fpr-rs4 UTSW 17 18022027 nonsense probably null
R0383:Fpr-rs4 UTSW 17 18022097 missense probably damaging 1.00
R0686:Fpr-rs4 UTSW 17 18022351 missense probably benign 0.05
R1551:Fpr-rs4 UTSW 17 18022327 missense possibly damaging 0.89
R1956:Fpr-rs4 UTSW 17 18022256 missense probably damaging 0.97
R2040:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2041:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2043:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2045:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2048:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2092:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2093:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R2136:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R3624:Fpr-rs4 UTSW 17 18022334 frame shift probably null
R4684:Fpr-rs4 UTSW 17 18022184 missense probably damaging 1.00
R6247:Fpr-rs4 UTSW 17 18022486 missense probably benign 0.00
R6639:Fpr-rs4 UTSW 17 18022132 nonsense probably null
R6757:Fpr-rs4 UTSW 17 18022132 nonsense probably null
Z1088:Fpr-rs4 UTSW 17 18021919 missense possibly damaging 0.85
Z1088:Fpr-rs4 UTSW 17 18022694 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTCGGTGTTCTAGGTAATGGGC -3'
(R):5'- GTACACATCCCCTCTTGCAT -3'

Sequencing Primer
(F):5'- CTAGGTAATGGGCTTGTGATTTG -3'
(R):5'- GCATCTCTCACTGTAGTCAAGAAGAG -3'
Posted On2017-07-14