Incidental Mutation 'R6077:Scn7a'
ID482774
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission 044238-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6077 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66697596 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 850 (N850I)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect probably damaging
Transcript: ENSMUST00000042792
AA Change: N850I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: N850I

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C T 11: 100,519,757 V132I probably benign Het
Adgrb3 A T 1: 25,094,000 L1335* probably null Het
Adgre5 A G 8: 83,727,966 S301P probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh1b1 A G 4: 45,802,525 Y21C possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd7 T A 6: 18,868,072 S112R probably benign Het
Arhgap23 T A 11: 97,491,232 probably null Het
Atp4a G A 7: 30,715,919 M321I probably benign Het
C2cd4d A T 3: 94,364,308 R294W probably damaging Het
Carns1 T C 19: 4,170,876 I352V probably benign Het
Cdh17 T A 4: 11,803,969 S547R probably benign Het
Cdyl2 G T 8: 116,589,390 N286K probably damaging Het
Fam186a C A 15: 99,942,703 V1887L possibly damaging Het
Fat4 C T 3: 39,002,802 R4216C probably damaging Het
Fcamr T C 1: 130,812,926 W361R probably damaging Het
Helz2 G A 2: 181,233,038 P1888S probably benign Het
Itih1 A T 14: 30,929,876 F840L possibly damaging Het
Kansl2 T C 15: 98,531,431 D146G probably benign Het
Kcnk18 T C 19: 59,235,314 V297A probably damaging Het
Kif1a T C 1: 93,054,896 T720A possibly damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Large2 C T 2: 92,366,570 R423K probably benign Het
Lgals3bp A G 11: 118,399,742 V13A probably damaging Het
Lrrd1 A G 5: 3,850,837 I381V probably benign Het
Mastl A T 2: 23,155,794 I23N probably damaging Het
Mettl23 T C 11: 116,848,902 V1A possibly damaging Het
Mindy2 A G 9: 70,631,081 V324A probably damaging Het
Mtmr4 T A 11: 87,611,019 L633Q probably damaging Het
Myh1 G A 11: 67,211,447 E855K probably damaging Het
Nin C T 12: 70,019,232 A2026T probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Olfr263 A T 13: 21,133,293 I173F probably benign Het
Otulin T C 15: 27,611,610 T166A probably benign Het
P2ry14 T A 3: 59,115,377 R230W probably damaging Het
Pcsk4 T C 10: 80,326,239 E83G probably damaging Het
Raet1e C A 10: 22,181,988 T218N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Safb G A 17: 56,602,956 probably benign Het
Slc16a4 A G 3: 107,301,065 D297G possibly damaging Het
Tcf7l2 A T 19: 55,917,436 K278* probably null Het
Tesmin T C 19: 3,389,260 V104A possibly damaging Het
Tiam1 A G 16: 89,798,030 probably null Het
Tmc4 T C 7: 3,667,527 T522A probably damaging Het
Tmprss3 T A 17: 31,189,167 I274F possibly damaging Het
Topbp1 A G 9: 103,332,990 K916E probably damaging Het
Trdv1 A G 14: 53,882,056 D58G probably benign Het
Ube2g2 G T 10: 77,622,305 probably benign Het
Unc5d G T 8: 28,675,307 Q747K possibly damaging Het
Xpo6 A G 7: 126,109,952 V819A possibly damaging Het
Zan T A 5: 137,414,297 probably benign Het
Zfp317 T A 9: 19,646,888 W133R probably benign Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66676192 missense probably damaging 1.00
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
R7813:Scn7a UTSW 2 66676345 missense probably damaging 1.00
R7833:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R7916:Scn7a UTSW 2 66676150 missense probably damaging 1.00
R8061:Scn7a UTSW 2 66692594 missense probably damaging 1.00
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Z1177:Scn7a UTSW 2 66752269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGTAGTTAGGTAAGGTGG -3'
(R):5'- AAGTGTTCCTACAGAAGCAACAG -3'

Sequencing Primer
(F):5'- AAGGTGGATTTAAAATCAAATGTGC -3'
(R):5'- CAGACCAAATATGTGATCCAAGTG -3'
Posted On2017-07-14