Incidental Mutation 'R0518:Ddx58'
ID48279
Institutional Source Beutler Lab
Gene Symbol Ddx58
Ensembl Gene ENSMUSG00000040296
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 58
SynonymsRIG-I, 6430573D20Rik
MMRRC Submission 038711-MU
Accession Numbers

Genbank: NM_172689; MGI:2442858

Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R0518 (G1)
Quality Score209
Status Not validated
Chromosome4
Chromosomal Location40203773-40239828 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 40216354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037907] [ENSMUST00000142055] [ENSMUST00000142055]
Predicted Effect probably null
Transcript: ENSMUST00000037907
SMART Domains Protein: ENSMUSP00000042433
Gene: ENSMUSG00000040296

DomainStartEndE-ValueType
Pfam:CARD_2 1 93 1.2e-31 PFAM
Pfam:CARD_2 99 189 6.2e-28 PFAM
DEXDc 240 453 8.61e-26 SMART
low complexity region 582 600 N/A INTRINSIC
HELICc 642 735 1.32e-12 SMART
Pfam:RIG-I_C-RD 807 924 4.4e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135966
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137903
Predicted Effect probably null
Transcript: ENSMUST00000142055
SMART Domains Protein: ENSMUSP00000115052
Gene: ENSMUSG00000040296

DomainStartEndE-ValueType
PDB:4NQK|D 1 153 3e-53 PDB
DEXDc 195 408 8.61e-26 SMART
low complexity region 537 555 N/A INTRINSIC
HELICc 597 690 1.32e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000142055
SMART Domains Protein: ENSMUSP00000115052
Gene: ENSMUSG00000040296

DomainStartEndE-ValueType
PDB:4NQK|D 1 153 3e-53 PDB
DEXDc 195 408 8.61e-26 SMART
low complexity region 537 555 N/A INTRINSIC
HELICc 597 690 1.32e-12 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases which are implicated in a number of cellular processes involving RNA binding and alteration of RNA secondary structure. This gene encodes a protein containing RNA helicase-DEAD box protein motifs and a caspase recruitment domain (CARD). It is involved in viral double-stranded (ds) RNA recognition and the regulation of immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null allele die in utero with liver apoptosis while survivors show impaired IFN induction and succumb to infection with certain RNA viruses. Homozygotes for another null allele are viable but develop colitis and progressive granulocytosis leading to chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Gene trapped(7)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Acaca A G 11: 84,290,286 probably null Het
Acsm5 T C 7: 119,535,800 V327A possibly damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Akr1c14 T C 13: 4,081,016 L236S probably damaging Het
Ammecr1l C T 18: 31,771,901 S65L probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Arhgef16 G T 4: 154,291,034 P168T probably damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Bank1 C T 3: 136,213,942 C364Y probably damaging Het
Cacna1s C A 1: 136,076,859 D132E probably benign Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Coa3 T A 11: 101,278,890 K13M probably damaging Het
Col13a1 A T 10: 61,862,746 M512K unknown Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crhbp C A 13: 95,443,895 probably null Het
Cryba2 T C 1: 74,890,125 Y153C possibly damaging Het
Cryzl2 T C 1: 157,464,430 V93A probably damaging Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Cyp2r1 T G 7: 114,552,900 H274P probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Dnd1 A G 18: 36,764,043 V350A possibly damaging Het
Dsg1b A T 18: 20,388,164 Q26L probably benign Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Fam20b C A 1: 156,687,456 V280F possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hk3 C T 13: 55,014,426 probably null Het
Hsd3b7 A G 7: 127,803,079 T330A probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kcnu1 T G 8: 25,910,888 L688R probably damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Kti12 T A 4: 108,848,579 V230E possibly damaging Het
Mgat5 T A 1: 127,384,847 I241N probably damaging Het
Mkln1 A G 6: 31,468,132 N321S probably benign Het
Mllt10 T G 2: 18,071,206 probably null Het
Ms4a1 C A 19: 11,258,679 probably null Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nipsnap3b T A 4: 53,021,343 F243I probably damaging Het
Ogfod1 T A 8: 94,055,248 probably null Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
P2ry14 T A 3: 59,115,204 E287D probably damaging Het
Pank4 A T 4: 154,976,625 R510S possibly damaging Het
Pcsk6 T A 7: 65,980,167 V347E possibly damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pik3c2b C A 1: 133,105,992 P1578H probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
Ppp1r26 A G 2: 28,452,302 D648G probably damaging Het
Ptprs A G 17: 56,419,621 probably null Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Ski A G 4: 155,159,286 probably null Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Slc25a36 A T 9: 97,097,175 I71N probably damaging Het
Syne2 A C 12: 76,108,862 probably null Het
Tdrd5 C A 1: 156,262,941 W845L probably damaging Het
Tfb2m T C 1: 179,537,824 I192V possibly damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tmem211 T A 5: 113,236,007 L97* probably null Het
Trank1 A C 9: 111,333,808 D45A probably damaging Het
Trim17 T A 11: 58,968,494 V178E probably damaging Het
Trim9 A T 12: 70,346,585 L195Q probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn1r4 G T 6: 56,956,898 C129F probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Wdr78 A C 4: 103,064,530 Y464* probably null Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Ddx58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ddx58 APN 4 40220389 splice site probably benign
IGL01344:Ddx58 APN 4 40208883 missense probably damaging 0.99
IGL01414:Ddx58 APN 4 40222176 missense probably damaging 1.00
IGL01529:Ddx58 APN 4 40225685 missense probably benign
IGL01756:Ddx58 APN 4 40209934 missense probably damaging 1.00
IGL02023:Ddx58 APN 4 40216487 missense possibly damaging 0.76
IGL02223:Ddx58 APN 4 40209993 missense possibly damaging 0.48
IGL02458:Ddx58 APN 4 40229536 missense probably damaging 0.98
IGL02937:Ddx58 APN 4 40229661 missense probably benign 0.00
IGL03358:Ddx58 APN 4 40206069 missense possibly damaging 0.54
E2594:Ddx58 UTSW 4 40235282 nonsense probably null
R0324:Ddx58 UTSW 4 40213766 missense probably benign 0.24
R0400:Ddx58 UTSW 4 40235257 missense probably benign 0.00
R0834:Ddx58 UTSW 4 40239596 missense possibly damaging 0.64
R1474:Ddx58 UTSW 4 40208868 missense possibly damaging 0.62
R1611:Ddx58 UTSW 4 40223862 missense probably damaging 1.00
R1803:Ddx58 UTSW 4 40224013 missense probably benign 0.00
R1906:Ddx58 UTSW 4 40206054 missense probably benign 0.01
R2072:Ddx58 UTSW 4 40224069 splice site probably null
R4696:Ddx58 UTSW 4 40203798 unclassified probably benign
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R5027:Ddx58 UTSW 4 40208845 missense probably benign
R5568:Ddx58 UTSW 4 40222140 missense probably benign
R6144:Ddx58 UTSW 4 40229551 missense probably benign 0.21
R6341:Ddx58 UTSW 4 40222199 critical splice acceptor site probably null
R6373:Ddx58 UTSW 4 40216487 missense possibly damaging 0.76
R6454:Ddx58 UTSW 4 40220456 missense probably damaging 0.99
R6456:Ddx58 UTSW 4 40213838 missense possibly damaging 0.73
R6523:Ddx58 UTSW 4 40205947 missense probably benign 0.00
R6593:Ddx58 UTSW 4 40226651 missense probably benign 0.02
R6741:Ddx58 UTSW 4 40211624 missense probably damaging 1.00
R6964:Ddx58 UTSW 4 40225697 missense probably benign 0.00
R7149:Ddx58 UTSW 4 40222079 missense possibly damaging 0.64
R7159:Ddx58 UTSW 4 40213804 missense probably benign 0.29
R7237:Ddx58 UTSW 4 40205938 missense probably benign 0.10
R7352:Ddx58 UTSW 4 40239668 missense probably benign 0.00
R7356:Ddx58 UTSW 4 40226600 missense probably benign 0.01
R7611:Ddx58 UTSW 4 40225651 missense probably damaging 1.00
R7615:Ddx58 UTSW 4 40229653 missense possibly damaging 0.59
R7729:Ddx58 UTSW 4 40206034 missense possibly damaging 0.53
R7759:Ddx58 UTSW 4 40225104 missense probably damaging 1.00
R7800:Ddx58 UTSW 4 40211618 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTCAGCCATGCTAAGGTCATGCTC -3'
(R):5'- GGCCATTCGCCATTAAACCCTCAG -3'

Sequencing Primer
(F):5'- TAAGGTCATGCTCCGTCACAG -3'
(R):5'- TGTAGTGACCATATGCGACC -3'
Posted On2013-06-12