Incidental Mutation 'R6077:Adgre5'
ID482794
Institutional Source Beutler Lab
Gene Symbol Adgre5
Ensembl Gene ENSMUSG00000002885
Gene Nameadhesion G protein-coupled receptor E5
SynonymsCd97, EGF-TM7 receptor
MMRRC Submission 044238-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6077 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location83723251-83741326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83727966 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 301 (S301P)
Ref Sequence ENSEMBL: ENSMUSP00000128220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000019576] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000109810] [ENSMUST00000140521] [ENSMUST00000166939] [ENSMUST00000172396] [ENSMUST00000212949]
Predicted Effect probably benign
Transcript: ENSMUST00000002964
AA Change: S303P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885
AA Change: S303P

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 167 1.78e-11 SMART
GPS 384 430 2.18e-8 SMART
Pfam:Dicty_CAR 431 703 1.3e-8 PFAM
Pfam:7tm_2 432 672 8.1e-68 PFAM
low complexity region 704 714 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019576
SMART Domains Protein: ENSMUSP00000019576
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000075843
AA Change: S397P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885
AA Change: S397P

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 165 213 1.38e-8 SMART
EGF_CA 214 261 1.78e-11 SMART
GPS 478 524 2.18e-8 SMART
Pfam:Dicty_CAR 525 798 4.6e-8 PFAM
Pfam:7tm_2 526 766 5.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109802
AA Change: S352P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885
AA Change: S352P

DomainStartEndE-ValueType
EGF 30 68 1.63e1 SMART
EGF_CA 69 119 5.92e-8 SMART
EGF_CA 120 168 1.38e-8 SMART
EGF_CA 169 216 1.78e-11 SMART
GPS 433 479 2.18e-8 SMART
Pfam:Dicty_CAR 480 752 5.3e-8 PFAM
Pfam:7tm_2 481 721 7.5e-67 PFAM
low complexity region 753 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109810
SMART Domains Protein: ENSMUSP00000105435
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139797
Predicted Effect probably benign
Transcript: ENSMUST00000140521
SMART Domains Protein: ENSMUSP00000116101
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 208 2.82e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154075
Predicted Effect probably benign
Transcript: ENSMUST00000166939
AA Change: S301P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885
AA Change: S301P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
EGF 28 66 1.63e1 SMART
EGF_CA 67 117 5.92e-8 SMART
EGF_CA 118 165 1.78e-11 SMART
GPS 382 428 2.18e-8 SMART
Pfam:Dicty_CAR 429 701 2.1e-7 PFAM
Pfam:7tm_2 430 670 1.7e-66 PFAM
low complexity region 702 712 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172396
SMART Domains Protein: ENSMUSP00000132222
Gene: ENSMUSG00000005481

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
DEXDc 63 264 4.06e-54 SMART
HELICc 300 381 9.09e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184114
Predicted Effect probably benign
Transcript: ENSMUST00000212949
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype apart from mild granulocytosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C T 11: 100,519,757 V132I probably benign Het
Adgrb3 A T 1: 25,094,000 L1335* probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh1b1 A G 4: 45,802,525 Y21C possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd7 T A 6: 18,868,072 S112R probably benign Het
Arhgap23 T A 11: 97,491,232 probably null Het
Atp4a G A 7: 30,715,919 M321I probably benign Het
C2cd4d A T 3: 94,364,308 R294W probably damaging Het
Carns1 T C 19: 4,170,876 I352V probably benign Het
Cdh17 T A 4: 11,803,969 S547R probably benign Het
Cdyl2 G T 8: 116,589,390 N286K probably damaging Het
Fam186a C A 15: 99,942,703 V1887L possibly damaging Het
Fat4 C T 3: 39,002,802 R4216C probably damaging Het
Fcamr T C 1: 130,812,926 W361R probably damaging Het
Helz2 G A 2: 181,233,038 P1888S probably benign Het
Itih1 A T 14: 30,929,876 F840L possibly damaging Het
Kansl2 T C 15: 98,531,431 D146G probably benign Het
Kcnk18 T C 19: 59,235,314 V297A probably damaging Het
Kif1a T C 1: 93,054,896 T720A possibly damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Large2 C T 2: 92,366,570 R423K probably benign Het
Lgals3bp A G 11: 118,399,742 V13A probably damaging Het
Lrrd1 A G 5: 3,850,837 I381V probably benign Het
Mastl A T 2: 23,155,794 I23N probably damaging Het
Mettl23 T C 11: 116,848,902 V1A possibly damaging Het
Mindy2 A G 9: 70,631,081 V324A probably damaging Het
Mtmr4 T A 11: 87,611,019 L633Q probably damaging Het
Myh1 G A 11: 67,211,447 E855K probably damaging Het
Nin C T 12: 70,019,232 A2026T probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Olfr263 A T 13: 21,133,293 I173F probably benign Het
Otulin T C 15: 27,611,610 T166A probably benign Het
P2ry14 T A 3: 59,115,377 R230W probably damaging Het
Pcsk4 T C 10: 80,326,239 E83G probably damaging Het
Raet1e C A 10: 22,181,988 T218N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Safb G A 17: 56,602,956 probably benign Het
Scn7a T A 2: 66,697,596 N850I probably damaging Het
Slc16a4 A G 3: 107,301,065 D297G possibly damaging Het
Tcf7l2 A T 19: 55,917,436 K278* probably null Het
Tesmin T C 19: 3,389,260 V104A possibly damaging Het
Tiam1 A G 16: 89,798,030 probably null Het
Tmc4 T C 7: 3,667,527 T522A probably damaging Het
Tmprss3 T A 17: 31,189,167 I274F possibly damaging Het
Topbp1 A G 9: 103,332,990 K916E probably damaging Het
Trdv1 A G 14: 53,882,056 D58G probably benign Het
Ube2g2 G T 10: 77,622,305 probably benign Het
Unc5d G T 8: 28,675,307 Q747K possibly damaging Het
Xpo6 A G 7: 126,109,952 V819A possibly damaging Het
Zan T A 5: 137,414,297 probably benign Het
Zfp317 T A 9: 19,646,888 W133R probably benign Het
Other mutations in Adgre5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Adgre5 APN 8 83728401 missense probably benign 0.01
IGL01365:Adgre5 APN 8 83723889 intron probably null
IGL01661:Adgre5 APN 8 83727935 missense probably damaging 0.99
IGL01707:Adgre5 APN 8 83724347 missense probably damaging 1.00
IGL01760:Adgre5 APN 8 83731957 missense probably benign 0.02
IGL02207:Adgre5 APN 8 83728284 missense probably damaging 1.00
IGL02483:Adgre5 APN 8 83725253 missense probably damaging 1.00
IGL03194:Adgre5 APN 8 83734018 missense possibly damaging 0.67
PIT4453001:Adgre5 UTSW 8 83724460 missense probably benign 0.08
R0024:Adgre5 UTSW 8 83728284 missense probably damaging 1.00
R0137:Adgre5 UTSW 8 83724898 missense probably damaging 1.00
R0257:Adgre5 UTSW 8 83731995 missense possibly damaging 0.54
R0485:Adgre5 UTSW 8 83731998 missense probably damaging 0.99
R0522:Adgre5 UTSW 8 83730176 missense probably benign 0.30
R0940:Adgre5 UTSW 8 83733497 missense probably damaging 1.00
R1372:Adgre5 UTSW 8 83728320 missense probably damaging 0.96
R1617:Adgre5 UTSW 8 83730177 missense possibly damaging 0.50
R1679:Adgre5 UTSW 8 83729405 missense probably benign 0.09
R1917:Adgre5 UTSW 8 83729109 missense probably damaging 0.99
R1918:Adgre5 UTSW 8 83729109 missense probably damaging 0.99
R2072:Adgre5 UTSW 8 83727804 missense probably benign 0.24
R2831:Adgre5 UTSW 8 83728394 missense possibly damaging 0.80
R5250:Adgre5 UTSW 8 83733440 missense probably benign
R5512:Adgre5 UTSW 8 83729086 missense probably benign
R7486:Adgre5 UTSW 8 83723886 missense probably damaging 1.00
R7733:Adgre5 UTSW 8 83729396 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TCGAGGCGAGCTTTTCAGTG -3'
(R):5'- ATGTTACCACAGTGCACCAC -3'

Sequencing Primer
(F):5'- GTTCGTGTTGGTCAGGAAGAC -3'
(R):5'- GTGCACCACGGCCAAACTTG -3'
Posted On2017-07-14