Incidental Mutation 'R6077:Itih1'
ID482811
Institutional Source Beutler Lab
Gene Symbol Itih1
Ensembl Gene ENSMUSG00000006529
Gene Nameinter-alpha trypsin inhibitor, heavy chain 1
Synonymsinter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1
MMRRC Submission 044238-MU
Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6077 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30929180-30943289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30929876 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 840 (F840L)
Ref Sequence ENSEMBL: ENSMUSP00000006704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006704
AA Change: F840L

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: F840L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 167 6e-79 SMART
low complexity region 240 251 N/A INTRINSIC
VWA 291 472 2.1e-32 SMART
Blast:VWA 528 577 5e-21 BLAST
Pfam:ITI_HC_C 706 892 2.1e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163118
AA Change: F836L

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: F836L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 163 2.44e-80 SMART
low complexity region 236 247 N/A INTRINSIC
VWA 287 468 3.43e-30 SMART
Blast:VWA 524 573 5e-21 BLAST
Pfam:ITI_HC_C 701 888 5.3e-81 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acly C T 11: 100,519,757 V132I probably benign Het
Adgrb3 A T 1: 25,094,000 L1335* probably null Het
Adgre5 A G 8: 83,727,966 S301P probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aldh1b1 A G 4: 45,802,525 Y21C possibly damaging Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Ankrd7 T A 6: 18,868,072 S112R probably benign Het
Arhgap23 T A 11: 97,491,232 probably null Het
Atp4a G A 7: 30,715,919 M321I probably benign Het
C2cd4d A T 3: 94,364,308 R294W probably damaging Het
Carns1 T C 19: 4,170,876 I352V probably benign Het
Cdh17 T A 4: 11,803,969 S547R probably benign Het
Cdyl2 G T 8: 116,589,390 N286K probably damaging Het
Fam186a C A 15: 99,942,703 V1887L possibly damaging Het
Fat4 C T 3: 39,002,802 R4216C probably damaging Het
Fcamr T C 1: 130,812,926 W361R probably damaging Het
Helz2 G A 2: 181,233,038 P1888S probably benign Het
Kansl2 T C 15: 98,531,431 D146G probably benign Het
Kcnk18 T C 19: 59,235,314 V297A probably damaging Het
Kif1a T C 1: 93,054,896 T720A possibly damaging Het
Kl C G 5: 150,953,001 F95L probably damaging Het
Large2 C T 2: 92,366,570 R423K probably benign Het
Lgals3bp A G 11: 118,399,742 V13A probably damaging Het
Lrrd1 A G 5: 3,850,837 I381V probably benign Het
Mastl A T 2: 23,155,794 I23N probably damaging Het
Mettl23 T C 11: 116,848,902 V1A possibly damaging Het
Mindy2 A G 9: 70,631,081 V324A probably damaging Het
Mtmr4 T A 11: 87,611,019 L633Q probably damaging Het
Myh1 G A 11: 67,211,447 E855K probably damaging Het
Nin C T 12: 70,019,232 A2026T probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Olfr263 A T 13: 21,133,293 I173F probably benign Het
Otulin T C 15: 27,611,610 T166A probably benign Het
P2ry14 T A 3: 59,115,377 R230W probably damaging Het
Pcsk4 T C 10: 80,326,239 E83G probably damaging Het
Raet1e C A 10: 22,181,988 T218N possibly damaging Het
Rsf1 GCGGCGGC GCGGCGGCGTCGGCGGC 7: 97,579,928 probably benign Het
Safb G A 17: 56,602,956 probably benign Het
Scn7a T A 2: 66,697,596 N850I probably damaging Het
Slc16a4 A G 3: 107,301,065 D297G possibly damaging Het
Tcf7l2 A T 19: 55,917,436 K278* probably null Het
Tesmin T C 19: 3,389,260 V104A possibly damaging Het
Tiam1 A G 16: 89,798,030 probably null Het
Tmc4 T C 7: 3,667,527 T522A probably damaging Het
Tmprss3 T A 17: 31,189,167 I274F possibly damaging Het
Topbp1 A G 9: 103,332,990 K916E probably damaging Het
Trdv1 A G 14: 53,882,056 D58G probably benign Het
Ube2g2 G T 10: 77,622,305 probably benign Het
Unc5d G T 8: 28,675,307 Q747K possibly damaging Het
Xpo6 A G 7: 126,109,952 V819A possibly damaging Het
Zan T A 5: 137,414,297 probably benign Het
Zfp317 T A 9: 19,646,888 W133R probably benign Het
Other mutations in Itih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Itih1 APN 14 30929821 missense probably benign 0.26
IGL00227:Itih1 APN 14 30942889 splice site probably null
IGL00902:Itih1 APN 14 30932482 splice site probably benign
IGL02194:Itih1 APN 14 30930365 missense probably benign 0.01
IGL02221:Itih1 APN 14 30929587 missense probably damaging 1.00
IGL02292:Itih1 APN 14 30933355 splice site probably null
IGL02733:Itih1 APN 14 30936720 missense probably damaging 1.00
IGL02928:Itih1 APN 14 30937758 missense probably damaging 1.00
IGL03064:Itih1 APN 14 30941557 missense probably benign 0.09
1mM(1):Itih1 UTSW 14 30929850 missense probably damaging 1.00
R0092:Itih1 UTSW 14 30940863 splice site probably benign
R0647:Itih1 UTSW 14 30935863 missense probably damaging 1.00
R0662:Itih1 UTSW 14 30933360 missense possibly damaging 0.63
R0744:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R0833:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R1070:Itih1 UTSW 14 30942456 splice site probably benign
R1397:Itih1 UTSW 14 30929905 splice site probably benign
R1797:Itih1 UTSW 14 30929899 missense probably damaging 1.00
R1898:Itih1 UTSW 14 30932287 missense probably benign
R1964:Itih1 UTSW 14 30929623 missense probably damaging 1.00
R1967:Itih1 UTSW 14 30941984 missense possibly damaging 0.67
R2086:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R2155:Itih1 UTSW 14 30938071 missense probably damaging 1.00
R2156:Itih1 UTSW 14 30933475 missense possibly damaging 0.88
R2225:Itih1 UTSW 14 30929577 missense possibly damaging 0.88
R3836:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3837:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3839:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R4388:Itih1 UTSW 14 30941555 missense possibly damaging 0.93
R4504:Itih1 UTSW 14 30935885 missense probably damaging 1.00
R4618:Itih1 UTSW 14 30929831 missense probably benign 0.33
R4682:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R4856:Itih1 UTSW 14 30936701 critical splice donor site probably null
R4886:Itih1 UTSW 14 30936701 critical splice donor site probably null
R5169:Itih1 UTSW 14 30933446 nonsense probably null
R5773:Itih1 UTSW 14 30935399 missense possibly damaging 0.89
R5875:Itih1 UTSW 14 30929530 missense probably benign
R6048:Itih1 UTSW 14 30929823 missense possibly damaging 0.89
R6175:Itih1 UTSW 14 30931195 missense probably damaging 1.00
R6228:Itih1 UTSW 14 30931260 missense probably benign 0.00
R6664:Itih1 UTSW 14 30933436 missense probably damaging 1.00
R6675:Itih1 UTSW 14 30929841 missense possibly damaging 0.50
R7059:Itih1 UTSW 14 30931309 missense possibly damaging 0.93
R7168:Itih1 UTSW 14 30934107 missense probably null 0.98
R7408:Itih1 UTSW 14 30943160 missense probably benign 0.00
R7458:Itih1 UTSW 14 30943266 start codon destroyed probably null
R7717:Itih1 UTSW 14 30931185 missense probably damaging 1.00
R8016:Itih1 UTSW 14 30935294 missense probably damaging 0.96
R8035:Itih1 UTSW 14 30942525 missense probably benign 0.25
Z1177:Itih1 UTSW 14 30929572 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGATAGCTGCTGTCCCTCTTTAG -3'
(R):5'- TGGGCAAAACATCACTTCACAG -3'

Sequencing Primer
(F):5'- GGAGGTTCACCCTACCCACATG -3'
(R):5'- TCACTTCACAGAAAGGTCAGAGGTC -3'
Posted On2017-07-14