Incidental Mutation 'R6079:Lrrc19'
ID482849
Institutional Source Beutler Lab
Gene Symbol Lrrc19
Ensembl Gene ENSMUSG00000049799
Gene Nameleucine rich repeat containing 19
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6079 (G1)
Quality Score102.008
Status Not validated
Chromosome4
Chromosomal Location94636653-94650144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94643343 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 11 (F11I)
Ref Sequence ENSEMBL: ENSMUSP00000102718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000053419] [ENSMUST00000107101] [ENSMUST00000107104]
Predicted Effect probably benign
Transcript: ENSMUST00000030311
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053419
AA Change: F11I

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056094
Gene: ENSMUSG00000049799
AA Change: F11I

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 250 364 8.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107101
AA Change: F11I

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102718
Gene: ENSMUSG00000049799
AA Change: F11I

DomainStartEndE-ValueType
LRR 69 93 3.36e2 SMART
LRR 94 117 4.32e0 SMART
LRR 118 141 1.71e1 SMART
LRR 142 166 1.09e2 SMART
LRRCT 174 225 1.24e-6 SMART
Pfam:LRR19-TM 245 364 9.3e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107104
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Lrrc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01640:Lrrc19 APN 4 94638508 missense probably damaging 0.99
IGL02585:Lrrc19 APN 4 94643325 missense probably benign 0.00
R0087:Lrrc19 UTSW 4 94640772 missense probably damaging 1.00
R0629:Lrrc19 UTSW 4 94638252 missense probably damaging 1.00
R1172:Lrrc19 UTSW 4 94638389 nonsense probably null
R1572:Lrrc19 UTSW 4 94638429 missense probably damaging 1.00
R1576:Lrrc19 UTSW 4 94639353 missense probably damaging 1.00
R1589:Lrrc19 UTSW 4 94640950 missense probably benign 0.24
R2107:Lrrc19 UTSW 4 94639294 missense probably benign
R4734:Lrrc19 UTSW 4 94638349 missense probably benign 0.01
R4932:Lrrc19 UTSW 4 94640937 missense probably damaging 1.00
R6969:Lrrc19 UTSW 4 94639373 missense probably benign 0.44
R7293:Lrrc19 UTSW 4 94638390 missense probably benign 0.07
R7596:Lrrc19 UTSW 4 94643355 missense probably benign
R7914:Lrrc19 UTSW 4 94638300 missense probably damaging 0.97
R8333:Lrrc19 UTSW 4 94639350 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCCCAGAGGTTACAGAATTTTAG -3'
(R):5'- AAACCCTGAACCTCAGTGTC -3'

Sequencing Primer
(F):5'- TAGCTGCTAAGACATCTCACTGG -3'
(R):5'- TGAACCTCAGTGTCCACAGG -3'
Posted On2017-07-14