Incidental Mutation 'R6079:Gkn3'
ID482852
Institutional Source Beutler Lab
Gene Symbol Gkn3
Ensembl Gene ENSMUSG00000030048
Gene Namegastrokine 3
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6079 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location87383256-87388935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87383525 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 163 (A163T)
Ref Sequence ENSEMBL: ENSMUSP00000032127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032127] [ENSMUST00000032128]
Predicted Effect probably damaging
Transcript: ENSMUST00000032127
AA Change: A163T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032127
Gene: ENSMUSG00000030048
AA Change: A163T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BRICHOS 63 155 1.47e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032128
SMART Domains Protein: ENSMUSP00000032128
Gene: ENSMUSG00000030049

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
BRICHOS 54 151 6.63e-34 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Gkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Gkn3 APN 6 87383511 missense possibly damaging 0.70
IGL02746:Gkn3 APN 6 87387357 splice site probably benign
IGL03345:Gkn3 APN 6 87388816 missense probably null 0.09
R1758:Gkn3 UTSW 6 87388835 start codon destroyed probably benign
R2303:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2304:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2363:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2365:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2897:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2898:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2983:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3031:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3426:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3433:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4085:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4086:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4087:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4088:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4089:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4090:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4164:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4720:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4721:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4722:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4723:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4766:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4941:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5004:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6078:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6502:Gkn3 UTSW 6 87388804 missense probably benign 0.01
R6924:Gkn3 UTSW 6 87388802 missense probably benign 0.05
R7695:Gkn3 UTSW 6 87384440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGTAGAAATGCACTTATTCCC -3'
(R):5'- GCTAAGGGGTTACAAAGCGC -3'

Sequencing Primer
(F):5'- CCAGATCACAAGGTTCCATGGG -3'
(R):5'- GGTTACAAAGCGCAATAAAAGAACC -3'
Posted On2017-07-14