Incidental Mutation 'R6079:Olfr510'
ID482856
Institutional Source Beutler Lab
Gene Symbol Olfr510
Ensembl Gene ENSMUSG00000096209
Gene Nameolfactory receptor 510
SynonymsMOR204-34, GA_x6K02T2PBJ9-10997715-10998659
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6079 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108666418-108670259 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108668205 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 263 (V263E)
Ref Sequence ENSEMBL: ENSMUSP00000149693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076289] [ENSMUST00000213979] [ENSMUST00000216331] [ENSMUST00000217170]
Predicted Effect probably damaging
Transcript: ENSMUST00000076289
AA Change: V263E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075637
Gene: ENSMUSG00000096209
AA Change: V263E

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 3e-50 PFAM
Pfam:7tm_1 44 293 4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210621
AA Change: V263E
Predicted Effect probably damaging
Transcript: ENSMUST00000213979
AA Change: V263E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000216331
AA Change: V263E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000217170
AA Change: V263E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Olfr510
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Olfr510 APN 7 108667700 missense possibly damaging 0.61
IGL00952:Olfr510 APN 7 108668238 missense possibly damaging 0.89
IGL01358:Olfr510 APN 7 108667662 missense possibly damaging 0.90
IGL01663:Olfr510 APN 7 108667891 missense probably benign 0.01
IGL02686:Olfr510 APN 7 108667886 missense probably benign 0.00
PIT4466001:Olfr510 UTSW 7 108667536 missense possibly damaging 0.52
R0095:Olfr510 UTSW 7 108668045 missense probably benign 0.00
R0095:Olfr510 UTSW 7 108668045 missense probably benign 0.00
R0792:Olfr510 UTSW 7 108668157 missense probably damaging 1.00
R0925:Olfr510 UTSW 7 108668193 missense probably benign 0.00
R1829:Olfr510 UTSW 7 108667644 missense probably benign 0.24
R2092:Olfr510 UTSW 7 108667662 frame shift probably null
R2483:Olfr510 UTSW 7 108667662 frame shift probably null
R3619:Olfr510 UTSW 7 108667850 missense probably benign 0.00
R4386:Olfr510 UTSW 7 108668253 missense probably damaging 0.99
R5298:Olfr510 UTSW 7 108668072 missense probably benign 0.00
R5622:Olfr510 UTSW 7 108668082 missense probably benign
R6138:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
R8359:Olfr510 UTSW 7 108668311 missense probably benign 0.00
U15987:Olfr510 UTSW 7 108668205 missense probably damaging 0.97
Z1177:Olfr510 UTSW 7 108667836 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCTCCTGTTCTGATAATAGTGTC -3'
(R):5'- CCAGGATCTTGCCAATTATACATG -3'

Sequencing Primer
(F):5'- ATTCTTGATTCATTTTCTACTGGCAC -3'
(R):5'- TGTAACATGAAATTTGAACCCCC -3'
Posted On2017-07-14