Incidental Mutation 'R6079:Anxa10'
ID482858
Institutional Source Beutler Lab
Gene Symbol Anxa10
Ensembl Gene ENSMUSG00000031635
Gene Nameannexin A10
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6079 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location62057042-62123150 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 62077926 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 83 (M83I)
Ref Sequence ENSEMBL: ENSMUSP00000034054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034052] [ENSMUST00000034054]
Predicted Effect probably benign
Transcript: ENSMUST00000034052
AA Change: M83I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034052
Gene: ENSMUSG00000031635
AA Change: M83I

DomainStartEndE-ValueType
ANX 34 86 6.71e-16 SMART
ANX 106 158 8.13e-15 SMART
ANX 198 241 5.48e-2 SMART
ANX 264 316 6.51e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000034054
AA Change: M83I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034054
Gene: ENSMUSG00000031635
AA Change: M83I

DomainStartEndE-ValueType
ANX 34 86 6.71e-16 SMART
ANX 106 161 2.38e-1 SMART
ANX 178 221 5.48e-2 SMART
ANX 244 296 6.51e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210799
Meta Mutation Damage Score 0.0786 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the annexin family. Members of this calcium-dependent phospholipid-binding protein family play a role in the regulation of cellular growth and in signal transduction pathways. The function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Litter sizes from crosses of females that are either homozygous or heterozygous for a null allele contain fewer pups than wild-type females, indicating a dominant maternal effect on embryonic lethality. Embryos of homozygous null females die between E4.5 and E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Anxa10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Anxa10 APN 8 62076314 missense probably damaging 1.00
IGL03354:Anxa10 APN 8 62096744 missense probably damaging 1.00
R0687:Anxa10 UTSW 8 62092572 missense possibly damaging 0.69
R0826:Anxa10 UTSW 8 62076284 nonsense probably null
R0883:Anxa10 UTSW 8 62077967 missense probably benign 0.40
R0945:Anxa10 UTSW 8 62060245 splice site probably benign
R1124:Anxa10 UTSW 8 62061004 splice site probably null
R1647:Anxa10 UTSW 8 62092584 missense probably damaging 1.00
R2877:Anxa10 UTSW 8 62060339 missense probably damaging 1.00
R3706:Anxa10 UTSW 8 62064287 missense probably damaging 1.00
R4677:Anxa10 UTSW 8 62063020 missense probably damaging 1.00
R5109:Anxa10 UTSW 8 62063059 missense possibly damaging 0.91
R5554:Anxa10 UTSW 8 62061046 missense possibly damaging 0.93
R5971:Anxa10 UTSW 8 62077926 missense probably benign 0.00
R6134:Anxa10 UTSW 8 62077943 missense probably damaging 1.00
R6857:Anxa10 UTSW 8 62061017 missense probably benign 0.19
R6901:Anxa10 UTSW 8 62096782 missense probably damaging 1.00
R7428:Anxa10 UTSW 8 62092509 missense probably benign 0.01
Z1088:Anxa10 UTSW 8 62092506 missense probably damaging 0.97
Z1176:Anxa10 UTSW 8 62063070 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AAATTGCAGGACCATCACAGGG -3'
(R):5'- CTCAAATCCATTGTCTAGTGTTACC -3'

Sequencing Primer
(F):5'- ACCATCACAGGGAAGTCTATCCTTTG -3'
(R):5'- GAGTGAGTCAAAACCAGACTTATTG -3'
Posted On2017-07-14