Incidental Mutation 'R6079:Msl1'
ID482863
Institutional Source Beutler Lab
Gene Symbol Msl1
Ensembl Gene ENSMUSG00000052915
Gene Namemale specific lethal 1
Synonyms4121402D02Rik, 4930463F05Rik, 2810017F12Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R6079 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location98795516-98807859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 98798693 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 9 (G9C)
Ref Sequence ENSEMBL: ENSMUSP00000043328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037915] [ENSMUST00000037930] [ENSMUST00000107485] [ENSMUST00000107487]
PDB Structure
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN DOSAGE COMPENSATION FACTORS MSL1 AND MOF [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE COMPLEX BETWEEN DOSAGE COMPENSATION FACTORS MSL1 AND MSL3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000037915
SMART Domains Protein: ENSMUSP00000042792
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
Pfam:MSL1_dimer 216 252 5e-22 PFAM
low complexity region 289 300 N/A INTRINSIC
low complexity region 441 453 N/A INTRINSIC
PEHE 475 593 1.8e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000037930
AA Change: G9C

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000043328
Gene: ENSMUSG00000052915
AA Change: G9C

DomainStartEndE-ValueType
coiled coil region 18 56 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 211 223 N/A INTRINSIC
PEHE 229 347 2.73e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107485
SMART Domains Protein: ENSMUSP00000103109
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
SCOP:d1fxkc_ 235 307 2e-3 SMART
low complexity region 441 453 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107487
SMART Domains Protein: ENSMUSP00000103111
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
low complexity region 55 91 N/A INTRINSIC
low complexity region 153 196 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
SCOP:d1fxkc_ 235 307 6e-3 SMART
low complexity region 441 453 N/A INTRINSIC
PEHE 459 577 2.73e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126969
SMART Domains Protein: ENSMUSP00000116598
Gene: ENSMUSG00000052915

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
Pfam:PEHE 88 141 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153181
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Msl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Msl1 APN 11 98805421 missense probably damaging 1.00
IGL01743:Msl1 APN 11 98805419 missense probably damaging 1.00
IGL01845:Msl1 APN 11 98805365 splice site probably null
R1458:Msl1 UTSW 11 98803982 splice site probably benign
R2377:Msl1 UTSW 11 98803963 missense probably damaging 1.00
R2979:Msl1 UTSW 11 98800224 missense possibly damaging 0.91
R4135:Msl1 UTSW 11 98796300 missense possibly damaging 0.85
R4801:Msl1 UTSW 11 98803969 nonsense probably null
R4802:Msl1 UTSW 11 98803969 nonsense probably null
R5971:Msl1 UTSW 11 98798693 missense probably benign 0.30
R6165:Msl1 UTSW 11 98804847 missense probably damaging 1.00
R6733:Msl1 UTSW 11 98800056 missense probably damaging 1.00
R6737:Msl1 UTSW 11 98804082 missense probably damaging 1.00
R7654:Msl1 UTSW 11 98796111 missense possibly damaging 0.72
R8316:Msl1 UTSW 11 98800248 missense probably damaging 0.98
U15987:Msl1 UTSW 11 98798693 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGTGGTACTGCTATCCCTAGGG -3'
(R):5'- TCTGGATGGCAAGAAGCTAG -3'

Sequencing Primer
(F):5'- TCCCTAGGGACGCTCTGTGAG -3'
(R):5'- ACTGGGCAGCCTGAAGC -3'
Posted On2017-07-14