Incidental Mutation 'R6079:Cdc20b'
ID482865
Institutional Source Beutler Lab
Gene Symbol Cdc20b
Ensembl Gene ENSMUSG00000078926
Gene Namecell division cycle 20B
SynonymsEG622422, EG238896
Accession Numbers

Genbank: XM_138861

Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6079 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location113035111-113091195 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113084042 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 485 (F485S)
Ref Sequence ENSEMBL: ENSMUSP00000104867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109244] [ENSMUST00000181117] [ENSMUST00000181568]
Predicted Effect probably damaging
Transcript: ENSMUST00000109244
AA Change: F485S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104867
Gene: ENSMUSG00000078926
AA Change: F485S

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 517 2.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181117
SMART Domains Protein: ENSMUSP00000137915
Gene: ENSMUSG00000078926

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 391 432 3.55e1 SMART
WD40 473 513 1.78e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000181568
AA Change: F443S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137849
Gene: ENSMUSG00000078926
AA Change: F443S

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
WD40 218 257 6.6e1 SMART
WD40 266 301 5.75e-1 SMART
WD40 304 341 9.24e-1 SMART
WD40 345 383 9.02e-7 SMART
WD40 431 475 2.01e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232584
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Cdc20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Cdc20b APN 13 113059785 missense possibly damaging 0.74
IGL02603:Cdc20b APN 13 113078755 missense possibly damaging 0.88
IGL02663:Cdc20b APN 13 113056131 critical splice donor site probably null
IGL03024:Cdc20b APN 13 113091042 missense possibly damaging 0.58
IGL03379:Cdc20b APN 13 113081202 missense probably damaging 1.00
H8930:Cdc20b UTSW 13 113083966 missense probably damaging 1.00
R0207:Cdc20b UTSW 13 113078612 missense probably damaging 1.00
R0347:Cdc20b UTSW 13 113059827 missense probably damaging 0.97
R0448:Cdc20b UTSW 13 113078657 missense probably damaging 1.00
R0499:Cdc20b UTSW 13 113055950 missense probably benign 0.00
R1573:Cdc20b UTSW 13 113055944 missense probably benign 0.26
R1651:Cdc20b UTSW 13 113078724 nonsense probably null
R1786:Cdc20b UTSW 13 113081134 missense probably damaging 1.00
R1929:Cdc20b UTSW 13 113071917 missense probably benign 0.07
R2118:Cdc20b UTSW 13 113078698 missense probably benign 0.30
R3436:Cdc20b UTSW 13 113078699 missense probably damaging 0.99
R3508:Cdc20b UTSW 13 113081042 missense possibly damaging 0.80
R3837:Cdc20b UTSW 13 113084008 missense probably damaging 1.00
R4050:Cdc20b UTSW 13 113064285 missense probably benign
R4521:Cdc20b UTSW 13 113081191 missense probably damaging 1.00
R4786:Cdc20b UTSW 13 113078734 missense probably damaging 1.00
R6610:Cdc20b UTSW 13 113064262 missense probably benign 0.02
R6814:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R6872:Cdc20b UTSW 13 113083975 missense probably damaging 1.00
R6887:Cdc20b UTSW 13 113078653 missense possibly damaging 0.88
R7144:Cdc20b UTSW 13 113083371 missense probably benign 0.36
R7579:Cdc20b UTSW 13 113037048 splice site probably null
R7770:Cdc20b UTSW 13 113078659 missense probably benign 0.01
R8669:Cdc20b UTSW 13 113071926 missense possibly damaging 0.83
U15987:Cdc20b UTSW 13 113084042 missense probably damaging 1.00
X0064:Cdc20b UTSW 13 113059742 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GCACATTCGCCATGCATCAG -3'
(R):5'- GATTGCTGCTGCCTAAAGC -3'

Sequencing Primer
(F):5'- TCGCCATGCATCAGAAGTTG -3'
(R):5'- GGAACCTGGACACTTTTAAGAGTTAG -3'
Posted On2017-07-14