Incidental Mutation 'R6079:Ppp4r1'
ID482868
Institutional Source Beutler Lab
Gene Symbol Ppp4r1
Ensembl Gene ENSMUSG00000061950
Gene Nameprotein phosphatase 4, regulatory subunit 1
SynonymsPp4r1, 3110001J10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6079 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location65782573-65841926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 65814348 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 268 (V268I)
Ref Sequence ENSEMBL: ENSMUSP00000125220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073104] [ENSMUST00000160664] [ENSMUST00000161127] [ENSMUST00000162109] [ENSMUST00000162272]
Predicted Effect probably benign
Transcript: ENSMUST00000073104
AA Change: V268I

PolyPhen 2 Score 0.196 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072848
Gene: ENSMUSG00000061950
AA Change: V268I

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 213 244 2e-5 PFAM
Pfam:HEAT 253 280 2.7e-6 PFAM
low complexity region 531 540 N/A INTRINSIC
PDB:3FGA|A 664 930 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160664
AA Change: V251I

PolyPhen 2 Score 0.303 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124690
Gene: ENSMUSG00000061950
AA Change: V251I

DomainStartEndE-ValueType
low complexity region 135 146 N/A INTRINSIC
Pfam:HEAT 236 263 2.2e-6 PFAM
low complexity region 514 523 N/A INTRINSIC
PDB:3FGA|A 647 913 3e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161100
Predicted Effect probably benign
Transcript: ENSMUST00000161127
SMART Domains Protein: ENSMUSP00000123862
Gene: ENSMUSG00000061950

DomainStartEndE-ValueType
SCOP:d1gw5a_ 25 154 1e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000162109
AA Change: V268I

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125220
Gene: ENSMUSG00000061950
AA Change: V268I

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 253 280 7.1e-7 PFAM
Pfam:HEAT 292 322 2.1e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162272
SMART Domains Protein: ENSMUSP00000124227
Gene: ENSMUSG00000061950

DomainStartEndE-ValueType
SCOP:d1gw5a_ 57 220 3e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162788
Meta Mutation Damage Score 0.0823 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several alternate regulatory subunits of serine/threonine protein phosphatase 4 (PP4). The protein features multiple HEAT repeats. This protein forms a complex with PP4RC. This complex may have a distinct role from other PP4 complexes, including regulation of HDAC3 (Zhang et al., PMID: 15805470). There is also a transcribed pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Ppp4r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ppp4r1 APN 17 65816019 missense probably benign 0.06
IGL01415:Ppp4r1 APN 17 65813527 missense probably damaging 1.00
IGL02166:Ppp4r1 APN 17 65813492 missense probably benign 0.01
IGL02672:Ppp4r1 APN 17 65840947 missense probably damaging 1.00
R0304:Ppp4r1 UTSW 17 65816006 missense probably benign
R0976:Ppp4r1 UTSW 17 65841018 makesense probably null
R1355:Ppp4r1 UTSW 17 65840987 missense probably benign
R2356:Ppp4r1 UTSW 17 65833050 missense probably damaging 0.99
R2405:Ppp4r1 UTSW 17 65811346 missense possibly damaging 0.95
R3054:Ppp4r1 UTSW 17 65836079 missense probably damaging 0.99
R4391:Ppp4r1 UTSW 17 65824754 missense probably benign 0.05
R4603:Ppp4r1 UTSW 17 65813464 missense probably damaging 1.00
R4763:Ppp4r1 UTSW 17 65835110 missense possibly damaging 0.90
R5571:Ppp4r1 UTSW 17 65803861 nonsense probably null
R5586:Ppp4r1 UTSW 17 65824568 missense probably benign 0.00
R5661:Ppp4r1 UTSW 17 65803968 critical splice donor site probably null
R5742:Ppp4r1 UTSW 17 65837746 missense probably damaging 0.97
R5971:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6138:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6303:Ppp4r1 UTSW 17 65824729 missense probably benign 0.10
R6684:Ppp4r1 UTSW 17 65824342 missense probably benign 0.00
R7058:Ppp4r1 UTSW 17 65829500 missense probably benign 0.00
R7397:Ppp4r1 UTSW 17 65837791 missense probably benign 0.28
R7448:Ppp4r1 UTSW 17 65840941 missense probably damaging 1.00
R7465:Ppp4r1 UTSW 17 65831020 nonsense probably null
R7528:Ppp4r1 UTSW 17 65813498 missense probably damaging 1.00
R7571:Ppp4r1 UTSW 17 65810616 missense possibly damaging 0.91
R7910:Ppp4r1 UTSW 17 65811303 missense probably benign 0.00
R7910:Ppp4r1 UTSW 17 65829399 missense probably damaging 1.00
R7972:Ppp4r1 UTSW 17 65833098 missense possibly damaging 0.90
U15987:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
Z1176:Ppp4r1 UTSW 17 65838926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTATACATCCACTGGCACGAG -3'
(R):5'- ACGTCCGTGCATGCATACAG -3'

Sequencing Primer
(F):5'- GCCTTTCTAGGGGGAGTTATAAAC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2017-07-14