Incidental Mutation 'R6079:Fam90a1b'
ID482872
Institutional Source Beutler Lab
Gene Symbol Fam90a1b
Ensembl Gene ENSMUSG00000043549
Gene Namefamily with sequence similarity 90, member A1B
Synonyms4932442L08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.031) question?
Stock #R6079 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location94355053-94366777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94356585 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 213 (N213S)
Ref Sequence ENSEMBL: ENSMUSP00000109536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044989] [ENSMUST00000113902] [ENSMUST00000113903]
Predicted Effect probably benign
Transcript: ENSMUST00000044989
AA Change: N213S

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000043958
Gene: ENSMUSG00000043549
AA Change: N213S

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
ZnF_C2HC 35 53 1.69e0 SMART
low complexity region 68 80 N/A INTRINSIC
low complexity region 86 107 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113902
Predicted Effect probably benign
Transcript: ENSMUST00000113903
AA Change: N213S

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109536
Gene: ENSMUSG00000043549
AA Change: N213S

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
ZnF_C2HC 35 53 1.69e0 SMART
low complexity region 68 80 N/A INTRINSIC
low complexity region 86 107 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAM90A1 belongs to subfamily I of the primate-specific FAM90A gene family, which originated from multiple duplications and rearrangements (Bosch et al., 2007 [PubMed 17684299]).[supplied by OMIM, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Fam90a1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Fam90a1b APN X 94356759 missense probably benign 0.02
R6067:Fam90a1b UTSW X 94356585 missense probably benign 0.23
R6078:Fam90a1b UTSW X 94356585 missense probably benign 0.23
U15987:Fam90a1b UTSW X 94356585 missense probably benign 0.23
Z1177:Fam90a1b UTSW X 94357042 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATCTTGAGCATCCTGGCTATC -3'
(R):5'- AGCAGACCAGCATTCATCTG -3'

Sequencing Primer
(F):5'- CTGTATGTGCTGCAGAATACAG -3'
(R):5'- CGATACTCAGGATAGTATGCAAGC -3'
Posted On2017-07-14