Incidental Mutation 'R6079:Pgk1'
ID482873
Institutional Source Beutler Lab
Gene Symbol Pgk1
Ensembl Gene ENSMUSG00000062070
Gene Namephosphoglycerate kinase 1
SynonymsPgk-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R6079 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location106187100-106203699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 106194492 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 85 (L85I)
Ref Sequence ENSEMBL: ENSMUSP00000080302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081593] [ENSMUST00000135949]
PDB Structure
Crystal Structure of mouse PGK1 3PG and terazosin(TZN) ternary complex [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081593
AA Change: L85I

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080302
Gene: ENSMUSG00000062070
AA Change: L85I

DomainStartEndE-ValueType
Pfam:PGK 9 406 1e-152 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133559
Predicted Effect possibly damaging
Transcript: ENSMUST00000135949
AA Change: L85I

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138706
Gene: ENSMUSG00000062070
AA Change: L85I

DomainStartEndE-ValueType
Pfam:PGK 8 253 3.9e-94 PFAM
Meta Mutation Damage Score 0.4493 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a glycolytic enzyme that catalyzes the conversion of 1,3-diphosphoglycerate to 3-phosphoglycerate. Additionally, this protein is secreted by tumor cells where it participates in angiogenesis by functioning to reduce disulfide bonds in the serine protease, plasmin, which consequently leads to the release of the tumor blood vessel inhibitor angiostatin. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Many pseudogenes of this gene are found throughout the mouse genome. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Satl1 T C X: 112,405,916 T281A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Pgk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1768:Pgk1 UTSW X 106200308 missense possibly damaging 0.73
R6067:Pgk1 UTSW X 106194492 missense possibly damaging 0.79
R6138:Pgk1 UTSW X 106194492 missense possibly damaging 0.79
U15987:Pgk1 UTSW X 106194492 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CTCGGAATAACATTGTTCTGCC -3'
(R):5'- TTCCAGCAGGATGACAGTCC -3'

Sequencing Primer
(F):5'- GGAATAACATTGTTCTGCCTTCTG -3'
(R):5'- ACAGGCATTCTCGACTTCTGGG -3'
Posted On2017-07-14