Incidental Mutation 'R6079:Satl1'
ID482874
Institutional Source Beutler Lab
Gene Symbol Satl1
Ensembl Gene ENSMUSG00000025527
Gene Namespermidine/spermine N1-acetyl transferase-like 1
Synonyms4930404K22Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6079 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location112384303-112406779 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112405916 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 281 (T281A)
Ref Sequence ENSEMBL: ENSMUSP00000026601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026601]
Predicted Effect probably benign
Transcript: ENSMUST00000026601
AA Change: T281A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026601
Gene: ENSMUSG00000025527
AA Change: T281A

DomainStartEndE-ValueType
internal_repeat_2 13 201 4.46e-7 PROSPERO
internal_repeat_1 30 255 8.83e-12 PROSPERO
low complexity region 260 271 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
internal_repeat_1 333 584 8.83e-12 PROSPERO
internal_repeat_2 399 595 4.46e-7 PROSPERO
Pfam:Acetyltransf_1 638 718 2.4e-10 PFAM
low complexity region 734 744 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124335
SMART Domains Protein: ENSMUSP00000122770
Gene: ENSMUSG00000025527

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
Pfam:Acetyltransf_1 327 407 1.5e-9 PFAM
low complexity region 423 433 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
Abcc8 T C 7: 46,105,844 M1511V probably benign Het
Adamts2 T A 11: 50,756,706 I302N probably damaging Het
Adgra2 G A 8: 27,114,429 A511T probably damaging Het
Anxa10 C A 8: 62,077,926 M83I probably benign Het
Atp2b4 TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT TTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTTCTT 1: 133,701,702 probably benign Het
Cdc20b T C 13: 113,084,042 F485S probably damaging Het
Edc4 C T 8: 105,887,548 R19C probably benign Het
Fam90a1b T C X: 94,356,585 N213S probably benign Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Itgae A G 11: 73,115,574 E356G possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lrrc19 A T 4: 94,643,343 F11I probably benign Het
Msl1 G T 11: 98,798,693 G9C probably benign Het
Muc4 T A 16: 32,755,247 probably benign Het
Myo7a C T 7: 98,065,790 W1558* probably null Het
Olfr510 T A 7: 108,668,205 V263E probably damaging Het
Pgk1 C A X: 106,194,492 L85I possibly damaging Het
Ppp4r1 G A 17: 65,814,348 V268I possibly damaging Het
Rad23b C T 4: 55,370,400 A142V probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Synrg A G 11: 84,024,300 E1044G probably damaging Het
Syt12 T C 19: 4,456,868 D83G probably benign Het
Taf4b T C 18: 14,822,198 C603R possibly damaging Het
Tbx5 T C 5: 119,883,146 S406P probably benign Het
Tfe3 T C X: 7,771,049 L231P probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Other mutations in Satl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Satl1 APN X 112405769 missense possibly damaging 0.95
R4246:Satl1 UTSW X 112406336 missense probably benign
R4247:Satl1 UTSW X 112406336 missense probably benign
R4248:Satl1 UTSW X 112406336 missense probably benign
R4249:Satl1 UTSW X 112406336 missense probably benign
R4250:Satl1 UTSW X 112406336 missense probably benign
R6067:Satl1 UTSW X 112405916 missense probably benign
R6138:Satl1 UTSW X 112405916 missense probably benign
U15987:Satl1 UTSW X 112405916 missense probably benign
Z1176:Satl1 UTSW X 112404992 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCCATCTGATGCATGCCTGG -3'
(R):5'- TGACTCATCTACCAGACAATTCG -3'

Sequencing Primer
(F):5'- GGTGCCTGATTGCCATACATC -3'
(R):5'- TTCGACTTGAGACAAGCAGGTCC -3'
Posted On2017-07-14