Incidental Mutation 'R6080:Zfp819'
ID 482884
Institutional Source Beutler Lab
Gene Symbol Zfp819
Ensembl Gene ENSMUSG00000055102
Gene Name zinc finger protein 819
Synonyms 4933405K07Rik, 4930427I11Rik
MMRRC Submission 044239-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock # R6080 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 43607169-43618285 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43616696 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 201 (H201R)
Ref Sequence ENSEMBL: ENSMUSP00000112026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032661] [ENSMUST00000116324] [ENSMUST00000120935] [ENSMUST00000127765]
AlphaFold Q80V81
Predicted Effect probably benign
Transcript: ENSMUST00000032661
AA Change: H201R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032661
Gene: ENSMUSG00000055102
AA Change: H201R

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116324
AA Change: H201R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112026
Gene: ENSMUSG00000055102
AA Change: H201R

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
ZnF_C2H2 300 327 5.4e1 SMART
ZnF_C2H2 356 378 3.74e-5 SMART
ZnF_C2H2 384 406 5.59e-4 SMART
ZnF_C2H2 412 434 1.36e-2 SMART
ZnF_C2H2 440 462 7.78e-3 SMART
ZnF_C2H2 468 490 5.9e-3 SMART
ZnF_C2H2 496 518 1.2e-3 SMART
ZnF_C2H2 524 546 4.79e-3 SMART
ZnF_C2H2 552 574 4.54e-4 SMART
ZnF_C2H2 580 602 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120935
AA Change: H125R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113867
Gene: ENSMUSG00000055102
AA Change: H125R

DomainStartEndE-ValueType
ZnF_C2H2 224 251 5.4e1 SMART
ZnF_C2H2 280 302 3.74e-5 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.36e-2 SMART
ZnF_C2H2 364 386 7.78e-3 SMART
ZnF_C2H2 392 414 5.9e-3 SMART
ZnF_C2H2 420 442 1.2e-3 SMART
ZnF_C2H2 448 470 4.79e-3 SMART
ZnF_C2H2 476 498 4.54e-4 SMART
ZnF_C2H2 504 526 3.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127765
SMART Domains Protein: ENSMUSP00000116658
Gene: ENSMUSG00000055102

DomainStartEndE-ValueType
KRAB 27 85 1.69e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 C T 14: 118,669,050 M44I possibly damaging Het
Anks1b C A 10: 90,966,349 S1209* probably null Het
Atp9b A G 18: 80,738,808 V1039A probably benign Het
Cep44 T C 8: 56,539,841 K246R possibly damaging Het
Cfap54 A T 10: 93,045,335 D330E possibly damaging Het
Dnah10 A T 5: 124,805,897 M2940L possibly damaging Het
Gm14326 T A 2: 177,936,546 T68S probably benign Het
Gm4922 A C 10: 18,784,752 I74S probably damaging Het
Ints14 G A 9: 64,966,762 V99I probably benign Het
Lrp4 T C 2: 91,502,000 S1681P probably benign Het
Lrp5 T C 19: 3,628,316 E513G probably benign Het
Myh14 T A 7: 44,655,611 N252I probably damaging Het
Naga A G 15: 82,334,847 V233A probably benign Het
Npc1 C T 18: 12,219,351 C97Y probably damaging Het
Olfr1309 T G 2: 111,983,705 Y123S probably damaging Het
Olfr1501 C A 19: 13,839,100 L24F possibly damaging Het
Olfr658 T C 7: 104,645,310 I19V probably benign Het
Olfr681 T C 7: 105,121,909 F151L probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Plag1 T C 4: 3,903,815 T459A probably benign Het
Rnase9 T C 14: 51,039,270 T84A probably benign Het
Rps6kb2 T A 19: 4,158,672 I282F probably benign Het
Smg5 A G 3: 88,351,509 T596A probably benign Het
Ugcg T C 4: 59,218,524 V256A possibly damaging Het
Uhrf1bp1 T C 17: 27,880,297 S278P probably benign Het
Vgll4 T C 6: 114,921,338 I21V probably benign Het
Vipas39 T A 12: 87,241,953 H426L probably damaging Het
Vmn1r224 A G 17: 20,419,556 T132A possibly damaging Het
Zc3h18 A G 8: 122,416,544 probably benign Het
Zfp606 T A 7: 12,494,116 N663K probably damaging Het
Zfp946 T A 17: 22,455,109 H281Q probably benign Het
Other mutations in Zfp819
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Zfp819 APN 7 43611979 splice site probably benign
IGL01732:Zfp819 APN 7 43616422 missense probably benign 0.13
IGL02139:Zfp819 APN 7 43612110 critical splice donor site probably null
IGL02276:Zfp819 APN 7 43612004 missense possibly damaging 0.84
R0306:Zfp819 UTSW 7 43617197 missense possibly damaging 0.92
R0620:Zfp819 UTSW 7 43616444 missense probably benign 0.07
R1301:Zfp819 UTSW 7 43617100 missense possibly damaging 0.94
R1314:Zfp819 UTSW 7 43617056 missense probably benign 0.27
R1980:Zfp819 UTSW 7 43616461 missense probably benign
R4545:Zfp819 UTSW 7 43617785 missense probably damaging 0.98
R4993:Zfp819 UTSW 7 43617296 missense probably benign 0.37
R5053:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R7289:Zfp819 UTSW 7 43617082 missense probably damaging 1.00
R7387:Zfp819 UTSW 7 43612641 critical splice donor site probably null
R7608:Zfp819 UTSW 7 43616933 missense probably benign
R7813:Zfp819 UTSW 7 43616767 missense probably benign
R7863:Zfp819 UTSW 7 43617892 missense probably benign 0.17
R8026:Zfp819 UTSW 7 43617895 missense probably benign 0.44
R8080:Zfp819 UTSW 7 43617724 missense probably damaging 1.00
R9072:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9073:Zfp819 UTSW 7 43617146 missense probably damaging 1.00
R9199:Zfp819 UTSW 7 43617779 missense probably benign 0.04
Z1176:Zfp819 UTSW 7 43617687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCATTATCGAGGAACCGTGG -3'
(R):5'- GCATAAATGGTTGCTGAGGG -3'

Sequencing Primer
(F):5'- GGTGGTGACCCTAAAACTTCAGATC -3'
(R):5'- GCTGGGAACACTTGCACATTG -3'
Posted On 2017-07-14