Incidental Mutation 'R0518:Mkln1'
ID 48289
Institutional Source Beutler Lab
Gene Symbol Mkln1
Ensembl Gene ENSMUSG00000025609
Gene Name muskelin 1, intracellular mediator containing kelch motifs
Synonyms
MMRRC Submission 038711-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock # R0518 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 31398735-31516811 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 31468132 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 321 (N321S)
Ref Sequence ENSEMBL: ENSMUSP00000026699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026699]
AlphaFold O89050
PDB Structure The crystal structure of discoidin domain from muskelin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026699
AA Change: N321S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000026699
Gene: ENSMUSG00000025609
AA Change: N321S

DomainStartEndE-ValueType
Pfam:F5_F8_type_C 20 150 5.8e-11 PFAM
LisH 172 204 4.68e-3 SMART
CTLH 206 258 5.29e-2 SMART
Pfam:Kelch_4 270 324 5.8e-7 PFAM
Pfam:Kelch_1 279 315 2.2e-8 PFAM
Pfam:Kelch_3 282 334 7.6e-13 PFAM
Pfam:Kelch_1 459 498 2.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141045
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147614
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150949
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Muskelin is an intracellular protein that acts as a mediator of cell spreading and cytoskeletal responses to the extracellular matrix component thrombospondin I (MIM 188060) (Adams et al., 1998 [PubMed 9724633]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit abnormal high-frequency ripple oscillation associated with GABA receptor internalization, intracellular trafficking, and degradation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2900011O08Rik T A 16: 13,986,812 S8T possibly damaging Het
Acaca A G 11: 84,290,286 probably null Het
Acsm5 T C 7: 119,535,800 V327A possibly damaging Het
Agt C A 8: 124,557,100 E427* probably null Het
Akr1c14 T C 13: 4,081,016 L236S probably damaging Het
Ammecr1l C T 18: 31,771,901 S65L probably benign Het
Ankrd33b T C 15: 31,367,286 D36G probably damaging Het
Ano8 A T 8: 71,479,258 C766S probably benign Het
Arhgef16 G T 4: 154,291,034 P168T probably damaging Het
Asic1 C T 15: 99,698,819 R499C probably damaging Het
Bank1 C T 3: 136,213,942 C364Y probably damaging Het
Cacna1s C A 1: 136,076,859 D132E probably benign Het
Capn5 C T 7: 98,132,882 R217Q probably damaging Het
Clasrp A G 7: 19,588,603 I284T probably benign Het
Coa3 T A 11: 101,278,890 K13M probably damaging Het
Col13a1 A T 10: 61,862,746 M512K unknown Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crhbp C A 13: 95,443,895 probably null Het
Cryba2 T C 1: 74,890,125 Y153C possibly damaging Het
Cryzl2 T C 1: 157,464,430 V93A probably damaging Het
Ctsl G A 13: 64,365,218 L297F possibly damaging Het
Cyp2r1 T G 7: 114,552,900 H274P probably benign Het
Ddx4 A T 13: 112,624,779 probably null Het
Ddx58 C T 4: 40,216,354 probably null Het
Dnd1 A G 18: 36,764,043 V350A possibly damaging Het
Dsg1b A T 18: 20,388,164 Q26L probably benign Het
Fam173b T G 15: 31,605,957 S20R probably benign Het
Fam20b C A 1: 156,687,456 V280F possibly damaging Het
Foxb2 G T 19: 16,872,456 C395* probably null Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Gm9930 A T 10: 9,534,803 noncoding transcript Het
Hdac7 G A 15: 97,806,499 Q497* probably null Het
Hk3 C T 13: 55,014,426 probably null Het
Hsd3b7 A G 7: 127,803,079 T330A probably benign Het
Il20ra A T 10: 19,759,640 Q543L probably damaging Het
Itk T A 11: 46,360,288 D163V probably damaging Het
Kcnu1 T G 8: 25,910,888 L688R probably damaging Het
Kng1 G A 16: 23,060,482 A45T possibly damaging Het
Kti12 T A 4: 108,848,579 V230E possibly damaging Het
Mgat5 T A 1: 127,384,847 I241N probably damaging Het
Mllt10 T G 2: 18,071,206 probably null Het
Ms4a1 C A 19: 11,258,679 probably null Het
Ngly1 C T 14: 16,290,774 Q419* probably null Het
Nipsnap3b T A 4: 53,021,343 F243I probably damaging Het
Ogfod1 T A 8: 94,055,248 probably null Het
Olfr1381 C T 11: 49,552,464 T239M probably damaging Het
Olfr624 T A 7: 103,670,489 I181F possibly damaging Het
Olfr714 T A 7: 107,074,758 L310Q possibly damaging Het
Olfr898 A C 9: 38,349,203 N40T probably damaging Het
P2ry14 T A 3: 59,115,204 E287D probably damaging Het
Pank4 A T 4: 154,976,625 R510S possibly damaging Het
Pcsk6 T A 7: 65,980,167 V347E possibly damaging Het
Peg3 T C 7: 6,711,428 E265G probably damaging Het
Pik3c2b C A 1: 133,105,992 P1578H probably damaging Het
Pkd1 A G 17: 24,595,219 S4188G probably benign Het
Ppp1r26 A G 2: 28,452,302 D648G probably damaging Het
Ptprs A G 17: 56,419,621 probably null Het
Rab24 A T 13: 55,320,925 probably null Het
Rap1gap2 A T 11: 74,441,766 M71K probably damaging Het
Rergl T G 6: 139,496,526 K42T probably damaging Het
Sept5 T C 16: 18,624,897 T92A probably benign Het
Ski A G 4: 155,159,286 probably null Het
Slc17a8 A G 10: 89,576,330 S414P probably benign Het
Slc25a36 A T 9: 97,097,175 I71N probably damaging Het
Syne2 A C 12: 76,108,862 probably null Het
Tdrd5 C A 1: 156,262,941 W845L probably damaging Het
Tfb2m T C 1: 179,537,824 I192V possibly damaging Het
Tll1 T G 8: 64,098,471 D292A probably damaging Het
Tmem211 T A 5: 113,236,007 L97* probably null Het
Trank1 A C 9: 111,333,808 D45A probably damaging Het
Trim17 T A 11: 58,968,494 V178E probably damaging Het
Trim9 A T 12: 70,346,585 L195Q probably damaging Het
Ttc27 A T 17: 74,856,549 R717S possibly damaging Het
Upk2 G T 9: 44,454,121 P50Q probably damaging Het
Usp9y A T Y: 1,307,880 C2319S probably benign Het
Vmn1r4 G T 6: 56,956,898 C129F probably benign Het
Vmn2r100 A T 17: 19,521,916 D184V probably damaging Het
Wdr78 A C 4: 103,064,530 Y464* probably null Het
Xpnpep3 T G 15: 81,427,492 I133S possibly damaging Het
Zfp628 A T 7: 4,919,940 Q387L probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Mkln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Mkln1 APN 6 31432990 missense probably damaging 0.99
IGL01569:Mkln1 APN 6 31428128 splice site probably benign
IGL01882:Mkln1 APN 6 31451534 missense probably benign
IGL02009:Mkln1 APN 6 31449520 missense probably benign 0.02
IGL02160:Mkln1 APN 6 31492791 splice site probably benign
IGL02994:Mkln1 APN 6 31490443 missense probably damaging 1.00
IGL03105:Mkln1 APN 6 31459059 nonsense probably null
PIT4377001:Mkln1 UTSW 6 31474354 missense probably damaging 1.00
R0376:Mkln1 UTSW 6 31478018 missense probably benign 0.00
R0446:Mkln1 UTSW 6 31449504 missense probably damaging 0.98
R0600:Mkln1 UTSW 6 31432927 splice site probably benign
R1066:Mkln1 UTSW 6 31418987 missense possibly damaging 0.85
R1248:Mkln1 UTSW 6 31489368 missense probably damaging 1.00
R1717:Mkln1 UTSW 6 31507644 missense probably benign
R1921:Mkln1 UTSW 6 31428178 missense probably benign 0.22
R1978:Mkln1 UTSW 6 31490530 nonsense probably null
R3836:Mkln1 UTSW 6 31468336 missense probably damaging 1.00
R3895:Mkln1 UTSW 6 31507667 missense probably damaging 1.00
R4456:Mkln1 UTSW 6 31426772 missense probably damaging 1.00
R4513:Mkln1 UTSW 6 31433158 intron probably benign
R4737:Mkln1 UTSW 6 31426799 missense probably damaging 1.00
R4819:Mkln1 UTSW 6 31474486 missense probably benign 0.00
R4960:Mkln1 UTSW 6 31459006 missense probably damaging 1.00
R5291:Mkln1 UTSW 6 31490481 missense possibly damaging 0.78
R5364:Mkln1 UTSW 6 31496712 missense probably damaging 1.00
R5739:Mkln1 UTSW 6 31496702 missense probably benign 0.00
R5797:Mkln1 UTSW 6 31433069 missense probably benign 0.21
R5890:Mkln1 UTSW 6 31490547 missense probably benign 0.02
R5940:Mkln1 UTSW 6 31489372 missense probably damaging 1.00
R6132:Mkln1 UTSW 6 31431220 missense probably damaging 0.98
R6521:Mkln1 UTSW 6 31490544 missense probably damaging 1.00
R7362:Mkln1 UTSW 6 31468168 missense probably benign 0.31
R7711:Mkln1 UTSW 6 31492649 missense probably damaging 0.99
R8094:Mkln1 UTSW 6 31492653 nonsense probably null
R8340:Mkln1 UTSW 6 31432943 missense possibly damaging 0.53
R8379:Mkln1 UTSW 6 31458965 nonsense probably null
R8972:Mkln1 UTSW 6 31496746 missense probably damaging 1.00
R9403:Mkln1 UTSW 6 31432970 missense not run
Z1176:Mkln1 UTSW 6 31398921 missense possibly damaging 0.74
Z1176:Mkln1 UTSW 6 31451554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGTTTCCTGGCAGATTTAAAACAC -3'
(R):5'- ACACCAACTTTGGTCCACCGTC -3'

Sequencing Primer
(F):5'- CTGGCAGATTTAAAACACTTGTAGGG -3'
(R):5'- CGGCAGCAGTATCTTCACTTAG -3'
Posted On 2013-06-12