Incidental Mutation 'R6080:Ints14'
ID482890
Institutional Source Beutler Lab
Gene Symbol Ints14
Ensembl Gene ENSMUSG00000034263
Gene Nameintegrator complex subunit 14
SynonymsVwa9, 2010321M09Rik
MMRRC Submission 044239-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R6080 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64960905-64986978 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64966762 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 99 (V99I)
Ref Sequence ENSEMBL: ENSMUSP00000127420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037504] [ENSMUST00000170517]
Predicted Effect probably benign
Transcript: ENSMUST00000037504
AA Change: V99I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000049284
Gene: ENSMUSG00000034263
AA Change: V99I

DomainStartEndE-ValueType
VWA 2 181 7.54e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170517
AA Change: V99I

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127420
Gene: ENSMUSG00000034263
AA Change: V99I

DomainStartEndE-ValueType
VWA 2 181 7.54e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215789
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 C T 14: 118,669,050 M44I possibly damaging Het
Anks1b C A 10: 90,966,349 S1209* probably null Het
Atp9b A G 18: 80,738,808 V1039A probably benign Het
Cep44 T C 8: 56,539,841 K246R possibly damaging Het
Cfap54 A T 10: 93,045,335 D330E possibly damaging Het
Dnah10 A T 5: 124,805,897 M2940L possibly damaging Het
Gm14326 T A 2: 177,936,546 T68S probably benign Het
Gm4922 A C 10: 18,784,752 I74S probably damaging Het
Lrp4 T C 2: 91,502,000 S1681P probably benign Het
Lrp5 T C 19: 3,628,316 E513G probably benign Het
Myh14 T A 7: 44,655,611 N252I probably damaging Het
Naga A G 15: 82,334,847 V233A probably benign Het
Npc1 C T 18: 12,219,351 C97Y probably damaging Het
Olfr1309 T G 2: 111,983,705 Y123S probably damaging Het
Olfr1501 C A 19: 13,839,100 L24F possibly damaging Het
Olfr658 T C 7: 104,645,310 I19V probably benign Het
Olfr681 T C 7: 105,121,909 F151L probably benign Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Plag1 T C 4: 3,903,815 T459A probably benign Het
Rnase9 T C 14: 51,039,270 T84A probably benign Het
Rps6kb2 T A 19: 4,158,672 I282F probably benign Het
Smg5 A G 3: 88,351,509 T596A probably benign Het
Ugcg T C 4: 59,218,524 V256A possibly damaging Het
Uhrf1bp1 T C 17: 27,880,297 S278P probably benign Het
Vgll4 T C 6: 114,921,338 I21V probably benign Het
Vipas39 T A 12: 87,241,953 H426L probably damaging Het
Vmn1r224 A G 17: 20,419,556 T132A possibly damaging Het
Zc3h18 A G 8: 122,416,544 probably benign Het
Zfp606 T A 7: 12,494,116 N663K probably damaging Het
Zfp819 A G 7: 43,616,696 H201R probably benign Het
Zfp946 T A 17: 22,455,109 H281Q probably benign Het
Other mutations in Ints14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Ints14 APN 9 64972792 missense probably benign 0.30
R0376:Ints14 UTSW 9 64983990 missense probably damaging 0.98
R0589:Ints14 UTSW 9 64979831 missense probably damaging 1.00
R0614:Ints14 UTSW 9 64964433 missense probably benign
R0708:Ints14 UTSW 9 64983984 missense probably benign 0.29
R1192:Ints14 UTSW 9 64966763 missense possibly damaging 0.86
R2114:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2115:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2117:Ints14 UTSW 9 64979795 missense probably damaging 1.00
R2484:Ints14 UTSW 9 64986084 missense probably benign
R4811:Ints14 UTSW 9 64964518 missense probably damaging 1.00
R4953:Ints14 UTSW 9 64982058 missense probably damaging 1.00
R5067:Ints14 UTSW 9 64964412 missense probably damaging 1.00
R6326:Ints14 UTSW 9 64964437 missense probably benign 0.08
R6395:Ints14 UTSW 9 64978124 splice site probably null
R7036:Ints14 UTSW 9 64964545 missense probably benign
R7147:Ints14 UTSW 9 64983985 missense possibly damaging 0.93
R7203:Ints14 UTSW 9 64964419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCACTGTATCCCCTTTGTAG -3'
(R):5'- GCTGGCTCATGTGCATATTAGC -3'

Sequencing Primer
(F):5'- GAACTCACTTTATAGACCAGGCTGG -3'
(R):5'- TCCAATACTGGGGCTTGAAC -3'
Posted On2017-07-14