Incidental Mutation 'R6081:Hlx'
ID482910
Institutional Source Beutler Lab
Gene Symbol Hlx
Ensembl Gene ENSMUSG00000039377
Gene NameH2.0-like homeobox
SynonymsHlx1
MMRRC Submission 044240-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6081 (G1)
Quality Score152.008
Status Not validated
Chromosome1
Chromosomal Location184727140-184732619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 184727697 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 415 (S415G)
Ref Sequence ENSEMBL: ENSMUSP00000040505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048572] [ENSMUST00000174257]
Predicted Effect probably benign
Transcript: ENSMUST00000048572
AA Change: S415G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040505
Gene: ENSMUSG00000039377
AA Change: S415G

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
HOX 271 335 2.32e-22 SMART
low complexity region 353 379 N/A INTRINSIC
low complexity region 405 434 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000174257
SMART Domains Protein: ENSMUSP00000134728
Gene: ENSMUSG00000039377

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 123 149 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
low complexity region 221 271 N/A INTRINSIC
low complexity region 344 357 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disrputions in this gene die as embryos as a result of defective organogenesis and fetal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,231 M33K probably damaging Het
4930556J24Rik T C 11: 3,938,140 Q82R unknown Het
Adcy9 T C 16: 4,294,681 D714G probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahctf1 G T 1: 179,781,672 A639E probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Anxa5 C T 3: 36,465,287 D18N probably damaging Het
Apc C T 18: 34,290,111 P299L possibly damaging Het
Btnl4 C A 17: 34,474,236 W68C probably damaging Het
Cmya5 T A 13: 93,144,513 probably benign Het
Cstf2t G T 19: 31,083,123 V20L probably benign Het
D630045J12Rik A T 6: 38,142,698 V1703E probably damaging Het
Dhx32 A G 7: 133,722,212 F535S probably damaging Het
Diras2 T C 13: 52,508,145 D42G probably damaging Het
Dppa3 T A 6: 122,629,972 D140E probably damaging Het
Gpr180 C T 14: 118,153,674 T205I probably benign Het
Gzme T G 14: 56,118,307 T183P possibly damaging Het
H2-T23 T A 17: 36,031,815 I144F possibly damaging Het
Krtap5-3 G A 7: 142,201,486 C20Y unknown Het
Mcm8 G T 2: 132,828,083 R359L probably benign Het
Mroh2b G C 15: 4,944,377 E1126Q probably damaging Het
Nav1 C T 1: 135,470,822 R674H probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Rnaset2b T A 17: 6,988,794 probably null Het
Samd12 T C 15: 53,719,678 K87E probably benign Het
Sec16b T C 1: 157,560,754 S564P probably benign Het
Speer4a A T 5: 26,034,962 C263* probably null Het
Susd1 C A 4: 59,411,359 C158F possibly damaging Het
Vmn2r6 C T 3: 64,556,532 V294M probably benign Het
Other mutations in Hlx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Hlx APN 1 184731595 missense probably damaging 1.00
IGL01074:Hlx APN 1 184727813 missense probably damaging 1.00
IGL02543:Hlx APN 1 184730751 missense probably damaging 1.00
R0522:Hlx UTSW 1 184731640 missense probably damaging 1.00
R1104:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1157:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1158:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1285:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1286:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1439:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1489:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1606:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1974:Hlx UTSW 1 184731987 missense probably damaging 0.99
R1976:Hlx UTSW 1 184731987 missense probably damaging 0.99
R2161:Hlx UTSW 1 184727641 missense probably benign 0.12
R2162:Hlx UTSW 1 184730692 splice site probably null
R2340:Hlx UTSW 1 184731987 missense probably damaging 0.99
R2341:Hlx UTSW 1 184731987 missense probably damaging 0.99
R3237:Hlx UTSW 1 184731987 missense probably damaging 0.99
R3781:Hlx UTSW 1 184731987 missense probably damaging 0.99
R3782:Hlx UTSW 1 184731987 missense probably damaging 0.99
R5705:Hlx UTSW 1 184730865 missense probably benign 0.40
R5738:Hlx UTSW 1 184731557 critical splice donor site probably null
R7323:Hlx UTSW 1 184730796 missense probably benign 0.00
R7373:Hlx UTSW 1 184730865 missense probably benign 0.40
X0018:Hlx UTSW 1 184727732 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TATAAACCTGCAAGCGGGGC -3'
(R):5'- ATGAAGTGGCGGCACTCTAAG -3'

Sequencing Primer
(F):5'- CCTGGGCGATCTCCGGG -3'
(R):5'- CACTCTAAGGAGGCGCAG -3'
Posted On2017-07-14