Incidental Mutation 'R6081:Susd1'
ID 482914
Institutional Source Beutler Lab
Gene Symbol Susd1
Ensembl Gene ENSMUSG00000038578
Gene Name sushi domain containing 1
Synonyms Gm12528
MMRRC Submission 044240-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.104) question?
Stock # R6081 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 59314683-59438633 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 59411359 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 158 (C158F)
Ref Sequence ENSEMBL: ENSMUSP00000103168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]
AlphaFold E9Q3H4
Predicted Effect possibly damaging
Transcript: ENSMUST00000040166
AA Change: C211F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578
AA Change: C211F

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 16 30 N/A INTRINSIC
EGF 43 77 1.36e1 SMART
EGF_CA 78 129 2.92e-7 SMART
EGF_CA 130 180 2.22e-12 SMART
CCP 184 239 7.87e-9 SMART
CCP 244 299 5.48e-8 SMART
Blast:FN3 306 379 2e-6 BLAST
Blast:FN3 459 580 8e-50 BLAST
transmembrane domain 729 751 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107544
AA Change: C158F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578
AA Change: C158F

DomainStartEndE-ValueType
EGF 28 76 2.02e-1 SMART
EGF_CA 77 127 2.22e-12 SMART
CCP 131 186 7.87e-9 SMART
CCP 191 246 5.48e-8 SMART
Blast:FN3 253 326 2e-6 BLAST
Blast:FN3 406 527 4e-50 BLAST
transmembrane domain 676 698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,231 M33K probably damaging Het
4930556J24Rik T C 11: 3,938,140 Q82R unknown Het
Adcy9 T C 16: 4,294,681 D714G probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahctf1 G T 1: 179,781,672 A639E probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Anxa5 C T 3: 36,465,287 D18N probably damaging Het
Apc C T 18: 34,290,111 P299L possibly damaging Het
Btnl4 C A 17: 34,474,236 W68C probably damaging Het
Cmya5 T A 13: 93,144,513 probably benign Het
Cstf2t G T 19: 31,083,123 V20L probably benign Het
D630045J12Rik A T 6: 38,142,698 V1703E probably damaging Het
Dhx32 A G 7: 133,722,212 F535S probably damaging Het
Diras2 T C 13: 52,508,145 D42G probably damaging Het
Dppa3 T A 6: 122,629,972 D140E probably damaging Het
Gpr180 C T 14: 118,153,674 T205I probably benign Het
Gzme T G 14: 56,118,307 T183P possibly damaging Het
H2-T23 T A 17: 36,031,815 I144F possibly damaging Het
Hlx T C 1: 184,727,697 S415G probably benign Het
Krtap5-3 G A 7: 142,201,486 C20Y unknown Het
Mcm8 G T 2: 132,828,083 R359L probably benign Het
Mroh2b G C 15: 4,944,377 E1126Q probably damaging Het
Nav1 C T 1: 135,470,822 R674H probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Rnaset2b T A 17: 6,988,794 probably null Het
Samd12 T C 15: 53,719,678 K87E probably benign Het
Sec16b T C 1: 157,560,754 S564P probably benign Het
Speer4a A T 5: 26,034,962 C263* probably null Het
Vmn2r6 C T 3: 64,556,532 V294M probably benign Het
Other mutations in Susd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Susd1 APN 4 59365817 missense possibly damaging 0.85
IGL01705:Susd1 APN 4 59332931 splice site probably benign
IGL01727:Susd1 APN 4 59412329 splice site probably benign
IGL02015:Susd1 APN 4 59315745 missense possibly damaging 0.86
IGL02102:Susd1 APN 4 59369636 missense possibly damaging 0.70
IGL02351:Susd1 APN 4 59427985 nonsense probably null
IGL02358:Susd1 APN 4 59427985 nonsense probably null
IGL03210:Susd1 APN 4 59333035 critical splice acceptor site probably null
IGL03258:Susd1 APN 4 59379655 missense possibly damaging 0.73
R0612:Susd1 UTSW 4 59390561 splice site probably benign
R0719:Susd1 UTSW 4 59329506 missense possibly damaging 0.56
R0722:Susd1 UTSW 4 59379749 missense possibly damaging 0.73
R1355:Susd1 UTSW 4 59424114 missense possibly damaging 0.86
R1672:Susd1 UTSW 4 59411395 missense probably damaging 0.98
R1677:Susd1 UTSW 4 59424089 missense possibly damaging 0.85
R1921:Susd1 UTSW 4 59412191 missense probably benign 0.03
R1933:Susd1 UTSW 4 59351695 missense possibly damaging 0.72
R1998:Susd1 UTSW 4 59349925 missense probably benign 0.03
R2202:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2203:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2204:Susd1 UTSW 4 59349843 missense possibly damaging 0.96
R2329:Susd1 UTSW 4 59379715 missense possibly damaging 0.85
R2510:Susd1 UTSW 4 59349855 missense possibly damaging 0.86
R4512:Susd1 UTSW 4 59329491 missense possibly damaging 0.96
R4732:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4733:Susd1 UTSW 4 59428029 missense possibly damaging 0.53
R4969:Susd1 UTSW 4 59351679 missense probably benign 0.04
R5121:Susd1 UTSW 4 59379657 missense possibly damaging 0.73
R5548:Susd1 UTSW 4 59369577 missense probably benign 0.05
R5747:Susd1 UTSW 4 59424108 missense probably damaging 0.98
R5776:Susd1 UTSW 4 59315363 utr 3 prime probably benign
R5875:Susd1 UTSW 4 59412203 missense possibly damaging 0.71
R6056:Susd1 UTSW 4 59379687 missense possibly damaging 0.53
R7018:Susd1 UTSW 4 59390627 missense probably benign 0.44
R7122:Susd1 UTSW 4 59411318 nonsense probably null
R7161:Susd1 UTSW 4 59329581 missense possibly damaging 0.85
R7172:Susd1 UTSW 4 59315420 splice site probably null
R7891:Susd1 UTSW 4 59349915 missense possibly damaging 0.85
R8103:Susd1 UTSW 4 59365916 critical splice acceptor site probably null
R8299:Susd1 UTSW 4 59315773 missense probably benign 0.33
R8472:Susd1 UTSW 4 59332985 missense possibly damaging 0.96
R8831:Susd1 UTSW 4 59379594 splice site probably benign
R8903:Susd1 UTSW 4 59390576 missense probably benign 0.02
R8981:Susd1 UTSW 4 59380883 missense probably benign 0.07
R9002:Susd1 UTSW 4 59324882 missense probably benign 0.00
R9091:Susd1 UTSW 4 59412226 missense probably benign 0.44
R9270:Susd1 UTSW 4 59412226 missense probably benign 0.44
R9296:Susd1 UTSW 4 59427865 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTGAATGCATTTATTCCCAAAGGG -3'
(R):5'- ATGTGCTCAGAAACATCGTGG -3'

Sequencing Primer
(F):5'- GAAACTGAAAAGCAACCTAGGGACAC -3'
(R):5'- TGAATCTAACACAGGGTCTGG -3'
Posted On 2017-07-14