Mutagenetix > Incidental Mutation

Incidental Mutation 'R6081:Susd1'

482914

Institutional Source

Beutler Lab

Gene Symbol

Susd1

Ensembl Gene

ENSMUSG00000038578

Gene Name

sushi domain containing 1

Synonyms

Gm12528

MMRRC Submission

044240-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R6081 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

59314683-59438633 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 59411359 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 158 (C158F)

Ref Sequence

ENSEMBL: ENSMUSP00000103168 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040166] [ENSMUST00000107544]

AlphaFold

E9Q3H4

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040166
AA Change: C211F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048201
Gene: ENSMUSG00000038578
AA Change: C211F

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	16	30	N/A	INTRINSIC
EGF	43	77	1.36e1	SMART
EGF_CA	78	129	2.92e-7	SMART
EGF_CA	130	180	2.22e-12	SMART
CCP	184	239	7.87e-9	SMART
CCP	244	299	5.48e-8	SMART
Blast:FN3	306	379	2e-6	BLAST
Blast:FN3	459	580	8e-50	BLAST
transmembrane domain	729	751	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107544
AA Change: C158F

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103168
Gene: ENSMUSG00000038578
AA Change: C158F

Domain	Start	End	E-Value	Type
EGF	28	76	2.02e-1	SMART
EGF_CA	77	127	2.22e-12	SMART
CCP	131	186	7.87e-9	SMART
CCP	191	246	5.48e-8	SMART
Blast:FN3	253	326	2e-6	BLAST
Blast:FN3	406	527	4e-50	BLAST
transmembrane domain	676	698	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,739,231	M33K	probably damaging	Het
4930556J24Rik	T	C	11: 3,938,140	Q82R	unknown	Het
Adcy9	T	C	16: 4,294,681	D714G	probably benign	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ahctf1	G	T	1: 179,781,672	A639E	probably benign	Het
Ank3	G	A	10: 70,002,565	R1566K	possibly damaging	Het
Anxa5	C	T	3: 36,465,287	D18N	probably damaging	Het
Apc	C	T	18: 34,290,111	P299L	possibly damaging	Het
Btnl4	C	A	17: 34,474,236	W68C	probably damaging	Het
Cmya5	T	A	13: 93,144,513		probably benign	Het
Cstf2t	G	T	19: 31,083,123	V20L	probably benign	Het
D630045J12Rik	A	T	6: 38,142,698	V1703E	probably damaging	Het
Dhx32	A	G	7: 133,722,212	F535S	probably damaging	Het
Diras2	T	C	13: 52,508,145	D42G	probably damaging	Het
Dppa3	T	A	6: 122,629,972	D140E	probably damaging	Het
Gpr180	C	T	14: 118,153,674	T205I	probably benign	Het
Gzme	T	G	14: 56,118,307	T183P	possibly damaging	Het
H2-T23	T	A	17: 36,031,815	I144F	possibly damaging	Het
Hlx	T	C	1: 184,727,697	S415G	probably benign	Het
Krtap5-3	G	A	7: 142,201,486	C20Y	unknown	Het
Mcm8	G	T	2: 132,828,083	R359L	probably benign	Het
Mroh2b	G	C	15: 4,944,377	E1126Q	probably damaging	Het
Nav1	C	T	1: 135,470,822	R674H	probably damaging	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Rnaset2b	T	A	17: 6,988,794		probably null	Het
Samd12	T	C	15: 53,719,678	K87E	probably benign	Het
Sec16b	T	C	1: 157,560,754	S564P	probably benign	Het
Speer4a	A	T	5: 26,034,962	C263*	probably null	Het
Vmn2r6	C	T	3: 64,556,532	V294M	probably benign	Het

Other mutations in Susd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01630:Susd1	APN	4	59365817	missense	possibly damaging	0.85
IGL01705:Susd1	APN	4	59332931	splice site	probably benign
IGL01727:Susd1	APN	4	59412329	splice site	probably benign
IGL02015:Susd1	APN	4	59315745	missense	possibly damaging	0.86
IGL02102:Susd1	APN	4	59369636	missense	possibly damaging	0.70
IGL02351:Susd1	APN	4	59427985	nonsense	probably null
IGL02358:Susd1	APN	4	59427985	nonsense	probably null
IGL03210:Susd1	APN	4	59333035	critical splice acceptor site	probably null
IGL03258:Susd1	APN	4	59379655	missense	possibly damaging	0.73
R0612:Susd1	UTSW	4	59390561	splice site	probably benign
R0719:Susd1	UTSW	4	59329506	missense	possibly damaging	0.56
R0722:Susd1	UTSW	4	59379749	missense	possibly damaging	0.73
R1355:Susd1	UTSW	4	59424114	missense	possibly damaging	0.86
R1672:Susd1	UTSW	4	59411395	missense	probably damaging	0.98
R1677:Susd1	UTSW	4	59424089	missense	possibly damaging	0.85
R1921:Susd1	UTSW	4	59412191	missense	probably benign	0.03
R1933:Susd1	UTSW	4	59351695	missense	possibly damaging	0.72
R1998:Susd1	UTSW	4	59349925	missense	probably benign	0.03
R2202:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2203:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2204:Susd1	UTSW	4	59349843	missense	possibly damaging	0.96
R2329:Susd1	UTSW	4	59379715	missense	possibly damaging	0.85
R2510:Susd1	UTSW	4	59349855	missense	possibly damaging	0.86
R4512:Susd1	UTSW	4	59329491	missense	possibly damaging	0.96
R4732:Susd1	UTSW	4	59428029	missense	possibly damaging	0.53
R4733:Susd1	UTSW	4	59428029	missense	possibly damaging	0.53
R4969:Susd1	UTSW	4	59351679	missense	probably benign	0.04
R5121:Susd1	UTSW	4	59379657	missense	possibly damaging	0.73
R5548:Susd1	UTSW	4	59369577	missense	probably benign	0.05
R5747:Susd1	UTSW	4	59424108	missense	probably damaging	0.98
R5776:Susd1	UTSW	4	59315363	utr 3 prime	probably benign
R5875:Susd1	UTSW	4	59412203	missense	possibly damaging	0.71
R6056:Susd1	UTSW	4	59379687	missense	possibly damaging	0.53
R7018:Susd1	UTSW	4	59390627	missense	probably benign	0.44
R7122:Susd1	UTSW	4	59411318	nonsense	probably null
R7161:Susd1	UTSW	4	59329581	missense	possibly damaging	0.85
R7172:Susd1	UTSW	4	59315420	splice site	probably null
R7891:Susd1	UTSW	4	59349915	missense	possibly damaging	0.85
R8103:Susd1	UTSW	4	59365916	critical splice acceptor site	probably null
R8299:Susd1	UTSW	4	59315773	missense	probably benign	0.33
R8472:Susd1	UTSW	4	59332985	missense	possibly damaging	0.96
R8831:Susd1	UTSW	4	59379594	splice site	probably benign
R8903:Susd1	UTSW	4	59390576	missense	probably benign	0.02
R8981:Susd1	UTSW	4	59380883	missense	probably benign	0.07
R9002:Susd1	UTSW	4	59324882	missense	probably benign	0.00
R9091:Susd1	UTSW	4	59412226	missense	probably benign	0.44
R9270:Susd1	UTSW	4	59412226	missense	probably benign	0.44
R9296:Susd1	UTSW	4	59427865	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTGAATGCATTTATTCCCAAAGGG -3'
(R):5'- ATGTGCTCAGAAACATCGTGG -3'

Sequencing Primer
(F):5'- GAAACTGAAAAGCAACCTAGGGACAC -3'
(R):5'- TGAATCTAACACAGGGTCTGG -3'

Posted On

2017-07-14