Incidental Mutation 'R6081:Diras2'
ID482924
Institutional Source Beutler Lab
Gene Symbol Diras2
Ensembl Gene ENSMUSG00000047842
Gene NameDIRAS family, GTP-binding RAS-like 2
Synonyms
MMRRC Submission 044240-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6081 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location52504380-52531279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52508145 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 42 (D42G)
Ref Sequence ENSEMBL: ENSMUSP00000055416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057442]
Predicted Effect probably damaging
Transcript: ENSMUST00000057442
AA Change: D42G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055416
Gene: ENSMUSG00000047842
AA Change: D42G

DomainStartEndE-ValueType
RAS 5 172 8.31e-85 SMART
low complexity region 181 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DIRAS2 belongs to a distinct branch of the functionally diverse Ras (see HRAS; MIM 190020) superfamily of monomeric GTPases.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,739,231 M33K probably damaging Het
4930556J24Rik T C 11: 3,938,140 Q82R unknown Het
Adcy9 T C 16: 4,294,681 D714G probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ahctf1 G T 1: 179,781,672 A639E probably benign Het
Ank3 G A 10: 70,002,565 R1566K possibly damaging Het
Anxa5 C T 3: 36,465,287 D18N probably damaging Het
Apc C T 18: 34,290,111 P299L possibly damaging Het
Btnl4 C A 17: 34,474,236 W68C probably damaging Het
Cmya5 T A 13: 93,144,513 probably benign Het
Cstf2t G T 19: 31,083,123 V20L probably benign Het
D630045J12Rik A T 6: 38,142,698 V1703E probably damaging Het
Dhx32 A G 7: 133,722,212 F535S probably damaging Het
Dppa3 T A 6: 122,629,972 D140E probably damaging Het
Gpr180 C T 14: 118,153,674 T205I probably benign Het
Gzme T G 14: 56,118,307 T183P possibly damaging Het
H2-T23 T A 17: 36,031,815 I144F possibly damaging Het
Hlx T C 1: 184,727,697 S415G probably benign Het
Krtap5-3 G A 7: 142,201,486 C20Y unknown Het
Mcm8 G T 2: 132,828,083 R359L probably benign Het
Mroh2b G C 15: 4,944,377 E1126Q probably damaging Het
Nav1 C T 1: 135,470,822 R674H probably damaging Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Rnaset2b T A 17: 6,988,794 probably null Het
Samd12 T C 15: 53,719,678 K87E probably benign Het
Sec16b T C 1: 157,560,754 S564P probably benign Het
Speer4a A T 5: 26,034,962 C263* probably null Het
Susd1 C A 4: 59,411,359 C158F possibly damaging Het
Vmn2r6 C T 3: 64,556,532 V294M probably benign Het
Other mutations in Diras2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02668:Diras2 APN 13 52507770 missense probably benign
PIT4515001:Diras2 UTSW 13 52507747 missense possibly damaging 0.56
R3721:Diras2 UTSW 13 52508023 missense probably damaging 1.00
R3722:Diras2 UTSW 13 52508023 missense probably damaging 1.00
R5175:Diras2 UTSW 13 52507971 missense probably damaging 1.00
R5425:Diras2 UTSW 13 52508047 missense probably damaging 1.00
R5496:Diras2 UTSW 13 52507750 missense probably benign 0.02
R5499:Diras2 UTSW 13 52507750 missense probably benign 0.02
R5501:Diras2 UTSW 13 52507750 missense probably benign 0.02
R5677:Diras2 UTSW 13 52507675 missense possibly damaging 0.96
R5949:Diras2 UTSW 13 52507711 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ATGGGCTTGAGTTCCTCCAG -3'
(R):5'- AAAGGCAAAATCCATGCTTTGGG -3'

Sequencing Primer
(F):5'- GGGACTGCCGGCTGGTG -3'
(R):5'- GGGGGTTTCAAATTAACTCTCCCAAC -3'
Posted On2017-07-14