Mutagenetix > Incidental Mutation

Incidental Mutation 'R6081:Apc'

482934

Institutional Source

Beutler Lab

Gene Symbol

Apc

Ensembl Gene

ENSMUSG00000005871

Gene Name

adenomatosis polyposis coli

Synonyms

CC1, Min

MMRRC Submission

044240-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.971) question?

Stock #

R6081 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34220924-34322189 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 34290111 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 299 (P299L)

Ref Sequence

ENSEMBL: ENSMUSP00000064214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066133] [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066133
AA Change: P299L

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064214
Gene: ENSMUSG00000005871
AA Change: P299L

Domain	Start	End	E-Value	Type
PDB:1DEB\|B	2	55	8e-29	PDB
low complexity region	92	109	N/A	INTRINSIC
Pfam:Suppressor_APC	124	206	2.3e-32	PFAM
low complexity region	211	222	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079362

SMART Domains

Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871

Domain	Start	End	E-Value	Type
Pfam:APC_N_CC	4	55	6e-32	PFAM
low complexity region	92	109	N/A	INTRINSIC
Pfam:Suppressor_APC	125	205	2e-24	PFAM
low complexity region	211	222	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
ARM	338	390	6.14e-5	SMART
ARM	457	508	1.62e-4	SMART
ARM	510	551	8.56e-4	SMART
ARM	554	595	4.45e-2	SMART
ARM	597	642	5.76e1	SMART
ARM	647	687	1.29e-7	SMART
Pfam:Arm_APC_u3	730	1017	5e-170	PFAM
Pfam:APC_15aa	1018	1032	1.1e-8	PFAM
Pfam:APC_u5	1034	1133	7.6e-55	PFAM
Pfam:APC_15aa	1154	1168	1.6e-8	PFAM
Pfam:APC_15aa	1171	1185	1.9e-9	PFAM
low complexity region	1187	1204	N/A	INTRINSIC
Pfam:APC_crr	1255	1279	1.5e-15	PFAM
Pfam:APC_u9	1280	1367	1.9e-34	PFAM
Pfam:APC_crr	1370	1393	2.2e-10	PFAM
low complexity region	1431	1449	N/A	INTRINSIC
Pfam:APC_crr	1485	1509	2.1e-9	PFAM
low complexity region	1532	1548	N/A	INTRINSIC
Pfam:SAMP	1568	1587	2.7e-11	PFAM
Pfam:APC_crr	1635	1659	1.9e-15	PFAM
Pfam:APC_u13	1660	1716	1.3e-31	PFAM
Pfam:SAMP	1717	1736	3.2e-12	PFAM
Pfam:APC_u14	1737	1837	1e-46	PFAM
Pfam:APC_crr	1839	1864	6.8e-15	PFAM
Pfam:APC_u15	1865	1945	1.8e-40	PFAM
Pfam:APC_crr	1947	1971	1.6e-14	PFAM
Pfam:APC_crr	2007	2030	1.8e-14	PFAM
Pfam:SAMP	2033	2052	1.6e-13	PFAM
low complexity region	2112	2146	N/A	INTRINSIC
Pfam:APC_basic	2223	2579	1.5e-110	PFAM
low complexity region	2626	2638	N/A	INTRINSIC
Pfam:EB1_binding	2670	2842	9.3e-89	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115781

SMART Domains

Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871

Domain	Start	End	E-Value	Type
PDB:1DEB\|B	2	55	1e-27	PDB
low complexity region	92	109	N/A	INTRINSIC
Pfam:Suppressor_APC	124	206	1.5e-31	PFAM
low complexity region	211	222	N/A	INTRINSIC
ARM	304	356	6.14e-5	SMART
ARM	423	474	1.62e-4	SMART
ARM	476	517	8.56e-4	SMART
ARM	520	561	4.45e-2	SMART
ARM	563	608	5.76e1	SMART
ARM	613	653	1.29e-7	SMART
Pfam:Arm	655	695	1.7e-6	PFAM
low complexity region	797	810	N/A	INTRINSIC
low complexity region	880	892	N/A	INTRINSIC
low complexity region	923	935	N/A	INTRINSIC
Pfam:APC_15aa	984	999	3.7e-9	PFAM
Pfam:APC_15aa	1100	1115	8.4e-8	PFAM
Pfam:APC_15aa	1120	1135	9.9e-9	PFAM
Pfam:APC_15aa	1137	1152	1.2e-9	PFAM
low complexity region	1153	1170	N/A	INTRINSIC
Pfam:APC_crr	1220	1245	7.5e-15	PFAM
low complexity region	1320	1331	N/A	INTRINSIC
Pfam:APC_crr	1334	1359	2.8e-11	PFAM
low complexity region	1397	1415	N/A	INTRINSIC
Pfam:APC_crr	1450	1475	2.2e-8	PFAM
low complexity region	1498	1514	N/A	INTRINSIC
Pfam:SAMP	1533	1553	8.4e-12	PFAM
Pfam:APC_crr	1600	1625	3.5e-13	PFAM
Pfam:SAMP	1682	1702	5e-12	PFAM
low complexity region	1732	1744	N/A	INTRINSIC
Pfam:APC_crr	1805	1830	3.1e-12	PFAM
low complexity region	1866	1877	N/A	INTRINSIC
Pfam:APC_crr	1912	1937	3.5e-13	PFAM
Pfam:APC_crr	1971	1996	7.1e-14	PFAM
Pfam:SAMP	1999	2018	4.6e-13	PFAM
low complexity region	2078	2112	N/A	INTRINSIC
Pfam:APC_basic	2189	2545	1.1e-131	PFAM
low complexity region	2592	2604	N/A	INTRINSIC
Pfam:EB1_binding	2636	2808	2.9e-90	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170023

Predicted Effect

probably benign
Transcript: ENSMUST00000171187

SMART Domains

Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871

Domain	Start	End	E-Value	Type
low complexity region	9	20	N/A	INTRINSIC
low complexity region	23	52	N/A	INTRINSIC
low complexity region	102	119	N/A	INTRINSIC
Pfam:Suppressor_APC	134	216	5.2e-32	PFAM
ARM	320	372	6.14e-5	SMART
ARM	439	490	1.62e-4	SMART
ARM	492	533	8.56e-4	SMART
ARM	536	577	4.45e-2	SMART
ARM	579	624	5.76e1	SMART
ARM	629	669	1.29e-7	SMART
Pfam:Arm	671	711	6.3e-7	PFAM
low complexity region	813	826	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
Pfam:APC_15aa	1000	1015	1.4e-9	PFAM
Pfam:APC_15aa	1116	1131	3.1e-8	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]

Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,739,231 (GRCm38)	M33K	probably damaging	Het
4930556J24Rik	T	C	11: 3,938,140 (GRCm38)	Q82R	unknown	Het
Adcy9	T	C	16: 4,294,681 (GRCm38)	D714G	probably benign	Het
Afg3l2	G	T	18: 67,421,259 (GRCm38)	L458M	probably damaging	Het
Ahctf1	G	T	1: 179,781,672 (GRCm38)	A639E	probably benign	Het
Ank3	G	A	10: 70,002,565 (GRCm38)	R1566K	possibly damaging	Het
Anxa5	C	T	3: 36,465,287 (GRCm38)	D18N	probably damaging	Het
Btnl4	C	A	17: 34,474,236 (GRCm38)	W68C	probably damaging	Het
Cmya5	T	A	13: 93,144,513 (GRCm38)		probably benign	Het
Cstf2t	G	T	19: 31,083,123 (GRCm38)	V20L	probably benign	Het
D630045J12Rik	A	T	6: 38,142,698 (GRCm38)	V1703E	probably damaging	Het
Dhx32	A	G	7: 133,722,212 (GRCm38)	F535S	probably damaging	Het
Diras2	T	C	13: 52,508,145 (GRCm38)	D42G	probably damaging	Het
Dppa3	T	A	6: 122,629,972 (GRCm38)	D140E	probably damaging	Het
Gpr180	C	T	14: 118,153,674 (GRCm38)	T205I	probably benign	Het
Gzme	T	G	14: 56,118,307 (GRCm38)	T183P	possibly damaging	Het
H2-T23	T	A	17: 36,031,815 (GRCm38)	I144F	possibly damaging	Het
Hlx	T	C	1: 184,727,697 (GRCm38)	S415G	probably benign	Het
Krtap5-3	G	A	7: 142,201,486 (GRCm38)	C20Y	unknown	Het
Mcm8	G	T	2: 132,828,083 (GRCm38)	R359L	probably benign	Het
Mroh2b	G	C	15: 4,944,377 (GRCm38)	E1126Q	probably damaging	Het
Nav1	C	T	1: 135,470,822 (GRCm38)	R674H	probably damaging	Het
Otx1	A	T	11: 21,999,406 (GRCm38)	L24H	probably damaging	Het
Rnaset2b	T	A	17: 6,988,794 (GRCm38)		probably null	Het
Samd12	T	C	15: 53,719,678 (GRCm38)	K87E	probably benign	Het
Sec16b	T	C	1: 157,560,754 (GRCm38)	S564P	probably benign	Het
Speer4a	A	T	5: 26,034,962 (GRCm38)	C263*	probably null	Het
Susd1	C	A	4: 59,411,359 (GRCm38)	C158F	possibly damaging	Het
Vmn2r6	C	T	3: 64,556,532 (GRCm38)	V294M	probably benign	Het

Other mutations in Apc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00507:Apc	APN	18	34,316,926 (GRCm38)	missense	probably benign	0.01
IGL00898:Apc	APN	18	34,317,094 (GRCm38)	missense	probably damaging	1.00
IGL01111:Apc	APN	18	34,315,136 (GRCm38)	missense	possibly damaging	0.95
IGL01347:Apc	APN	18	34,317,670 (GRCm38)	missense	probably damaging	1.00
IGL01375:Apc	APN	18	34,313,654 (GRCm38)	missense	probably damaging	1.00
IGL01805:Apc	APN	18	34,318,218 (GRCm38)	missense	probably benign	0.02
IGL01997:Apc	APN	18	34,315,423 (GRCm38)	missense	probably benign	0.00
IGL02033:Apc	APN	18	34,310,719 (GRCm38)	missense	probably damaging	1.00
IGL02323:Apc	APN	18	34,315,810 (GRCm38)	nonsense	probably null
IGL02373:Apc	APN	18	34,316,159 (GRCm38)	missense	probably damaging	1.00
IGL02379:Apc	APN	18	34,298,745 (GRCm38)	missense	probably benign	0.45
IGL02456:Apc	APN	18	34,313,882 (GRCm38)	nonsense	probably null
IGL02552:Apc	APN	18	34,312,982 (GRCm38)	missense	possibly damaging	0.90
IGL02676:Apc	APN	18	34,315,634 (GRCm38)	missense	probably damaging	1.00
IGL02756:Apc	APN	18	34,314,535 (GRCm38)	missense	probably damaging	1.00
IGL02938:Apc	APN	18	34,315,228 (GRCm38)	missense	probably damaging	0.98
IGL02974:Apc	APN	18	34,268,383 (GRCm38)	splice site	probably benign
IGL03124:Apc	APN	18	34,299,985 (GRCm38)	missense	probably damaging	0.98
IGL03201:Apc	APN	18	34,312,376 (GRCm38)	missense	probably damaging	1.00
IGL03339:Apc	APN	18	34,298,474 (GRCm38)	missense	probably damaging	1.00
FR4304:Apc	UTSW	18	34,281,997 (GRCm38)	intron	probably benign
FR4342:Apc	UTSW	18	34,281,999 (GRCm38)	intron	probably benign
FR4449:Apc	UTSW	18	34,282,005 (GRCm38)	intron	probably benign
FR4449:Apc	UTSW	18	34,282,000 (GRCm38)	intron	probably benign
FR4548:Apc	UTSW	18	34,281,998 (GRCm38)	intron	probably benign
FR4737:Apc	UTSW	18	34,281,999 (GRCm38)	intron	probably benign
FR4976:Apc	UTSW	18	34,282,004 (GRCm38)	nonsense	probably null
FR4976:Apc	UTSW	18	34,282,000 (GRCm38)	intron	probably benign
FR4976:Apc	UTSW	18	34,281,998 (GRCm38)	intron	probably benign
R0385:Apc	UTSW	18	34,315,944 (GRCm38)	missense	probably damaging	1.00
R0535:Apc	UTSW	18	34,261,072 (GRCm38)	missense	probably damaging	1.00
R0561:Apc	UTSW	18	34,313,303 (GRCm38)	missense	possibly damaging	0.94
R0590:Apc	UTSW	18	34,316,230 (GRCm38)	nonsense	probably null
R0626:Apc	UTSW	18	34,318,454 (GRCm38)	missense	probably damaging	1.00
R0991:Apc	UTSW	18	34,316,107 (GRCm38)	missense	probably damaging	1.00
R1564:Apc	UTSW	18	34,315,149 (GRCm38)	missense	probably benign	0.00
R1663:Apc	UTSW	18	34,268,325 (GRCm38)	missense	probably damaging	0.98
R1737:Apc	UTSW	18	34,317,022 (GRCm38)	missense	probably damaging	1.00
R1739:Apc	UTSW	18	34,312,318 (GRCm38)	missense	probably damaging	1.00
R1835:Apc	UTSW	18	34,317,077 (GRCm38)	missense	probably damaging	1.00
R1887:Apc	UTSW	18	34,272,468 (GRCm38)	missense	probably damaging	1.00
R1957:Apc	UTSW	18	34,317,335 (GRCm38)	missense	probably damaging	1.00
R1974:Apc	UTSW	18	34,300,004 (GRCm38)	missense	possibly damaging	0.62
R2005:Apc	UTSW	18	34,310,909 (GRCm38)	critical splice donor site	probably null
R2013:Apc	UTSW	18	34,315,591 (GRCm38)	missense	probably damaging	0.98
R2014:Apc	UTSW	18	34,315,591 (GRCm38)	missense	probably damaging	0.98
R2015:Apc	UTSW	18	34,315,591 (GRCm38)	missense	probably damaging	0.98
R2017:Apc	UTSW	18	34,313,602 (GRCm38)	missense	probably benign	0.00
R2056:Apc	UTSW	18	34,316,428 (GRCm38)	missense	probably damaging	1.00
R2108:Apc	UTSW	18	34,269,229 (GRCm38)	missense	probably damaging	1.00
R2120:Apc	UTSW	18	34,276,601 (GRCm38)	missense	probably damaging	1.00
R2131:Apc	UTSW	18	34,312,045 (GRCm38)	missense	possibly damaging	0.51
R2133:Apc	UTSW	18	34,312,045 (GRCm38)	missense	possibly damaging	0.51
R2291:Apc	UTSW	18	34,312,491 (GRCm38)	missense	probably benign	0.45
R2332:Apc	UTSW	18	34,317,059 (GRCm38)	missense	possibly damaging	0.50
R2360:Apc	UTSW	18	34,261,126 (GRCm38)	missense	probably damaging	1.00
R2407:Apc	UTSW	18	34,314,262 (GRCm38)	missense	possibly damaging	0.77
R2507:Apc	UTSW	18	34,316,537 (GRCm38)	missense	possibly damaging	0.77
R2940:Apc	UTSW	18	34,276,670 (GRCm38)	missense	probably damaging	1.00
R3404:Apc	UTSW	18	34,313,602 (GRCm38)	missense	probably benign	0.00
R3411:Apc	UTSW	18	34,269,259 (GRCm38)	splice site	probably benign
R3778:Apc	UTSW	18	34,313,081 (GRCm38)	missense	probably damaging	1.00
R3826:Apc	UTSW	18	34,279,335 (GRCm38)	missense	possibly damaging	0.93
R4599:Apc	UTSW	18	34,317,987 (GRCm38)	nonsense	probably null
R4611:Apc	UTSW	18	34,318,565 (GRCm38)	missense	probably damaging	1.00
R4664:Apc	UTSW	18	34,298,594 (GRCm38)	missense	probably damaging	0.98
R4969:Apc	UTSW	18	34,312,918 (GRCm38)	nonsense	probably null
R5007:Apc	UTSW	18	34,312,963 (GRCm38)	missense	probably damaging	1.00
R5066:Apc	UTSW	18	34,316,105 (GRCm38)	missense	probably damaging	1.00
R5112:Apc	UTSW	18	34,316,109 (GRCm38)	nonsense	probably null
R5259:Apc	UTSW	18	34,314,290 (GRCm38)	missense	probably benign	0.29
R5440:Apc	UTSW	18	34,221,160 (GRCm38)	unclassified	probably benign
R5508:Apc	UTSW	18	34,298,580 (GRCm38)	missense	probably damaging	0.97
R5512:Apc	UTSW	18	34,310,909 (GRCm38)	critical splice donor site	probably benign
R5850:Apc	UTSW	18	34,318,063 (GRCm38)	missense	possibly damaging	0.94
R5951:Apc	UTSW	18	34,317,146 (GRCm38)	missense	possibly damaging	0.89
R5966:Apc	UTSW	18	34,221,087 (GRCm38)	utr 5 prime	probably benign
R6116:Apc	UTSW	18	34,316,455 (GRCm38)	missense	probably damaging	1.00
R6351:Apc	UTSW	18	34,312,212 (GRCm38)	missense	probably damaging	1.00
R6354:Apc	UTSW	18	34,312,528 (GRCm38)	missense	probably benign	0.02
R6467:Apc	UTSW	18	34,269,199 (GRCm38)	missense	probably benign	0.22
R6974:Apc	UTSW	18	34,298,427 (GRCm38)	missense	possibly damaging	0.65
R7027:Apc	UTSW	18	34,312,076 (GRCm38)	missense	probably damaging	1.00
R7096:Apc	UTSW	18	34,315,957 (GRCm38)	missense	probably damaging	1.00
R7289:Apc	UTSW	18	34,315,271 (GRCm38)	missense	probably damaging	1.00
R7439:Apc	UTSW	18	34,312,073 (GRCm38)	missense	probably damaging	1.00
R7441:Apc	UTSW	18	34,312,073 (GRCm38)	missense	probably damaging	1.00
R7534:Apc	UTSW	18	34,316,962 (GRCm38)	missense	probably damaging	1.00
R7685:Apc	UTSW	18	34,314,208 (GRCm38)	missense	probably damaging	1.00
R7814:Apc	UTSW	18	34,272,539 (GRCm38)	missense	probably damaging	0.98
R7954:Apc	UTSW	18	34,314,268 (GRCm38)	missense	probably damaging	0.99
R8352:Apc	UTSW	18	34,312,751 (GRCm38)	missense	possibly damaging	0.54
R8452:Apc	UTSW	18	34,312,751 (GRCm38)	missense	possibly damaging	0.54
R8497:Apc	UTSW	18	34,313,030 (GRCm38)	missense	possibly damaging	0.81
R8545:Apc	UTSW	18	34,317,031 (GRCm38)	missense	possibly damaging	0.94
R8554:Apc	UTSW	18	34,312,946 (GRCm38)	missense	probably damaging	1.00
R8955:Apc	UTSW	18	34,268,317 (GRCm38)	missense	probably damaging	1.00
R9014:Apc	UTSW	18	34,221,021 (GRCm38)	start gained	probably benign
R9061:Apc	UTSW	18	34,313,198 (GRCm38)	missense	probably damaging	1.00
R9147:Apc	UTSW	18	34,317,657 (GRCm38)	missense	probably damaging	1.00
R9318:Apc	UTSW	18	34,313,987 (GRCm38)	missense	possibly damaging	0.69
R9521:Apc	UTSW	18	34,312,685 (GRCm38)	missense	probably benign	0.24
R9546:Apc	UTSW	18	34,312,258 (GRCm38)	missense	possibly damaging	0.86
R9547:Apc	UTSW	18	34,312,258 (GRCm38)	missense	possibly damaging	0.86
R9557:Apc	UTSW	18	34,318,359 (GRCm38)	missense	probably damaging	1.00
R9592:Apc	UTSW	18	34,310,770 (GRCm38)	nonsense	probably null
R9675:Apc	UTSW	18	34,316,194 (GRCm38)	missense	probably damaging	1.00
R9736:Apc	UTSW	18	34,317,770 (GRCm38)	missense	probably damaging	1.00
R9792:Apc	UTSW	18	34,314,575 (GRCm38)	missense	probably damaging	1.00
R9793:Apc	UTSW	18	34,314,575 (GRCm38)	missense	probably damaging	1.00
R9795:Apc	UTSW	18	34,314,575 (GRCm38)	missense	probably damaging	1.00
RF046:Apc	UTSW	18	34,282,009 (GRCm38)	critical splice donor site	probably benign
RF063:Apc	UTSW	18	34,282,009 (GRCm38)	critical splice donor site	probably benign
X0021:Apc	UTSW	18	34,312,108 (GRCm38)	missense	probably damaging	1.00
X0025:Apc	UTSW	18	34,312,376 (GRCm38)	missense	probably damaging	1.00
Z1088:Apc	UTSW	18	34,313,167 (GRCm38)	nonsense	probably null
Z1177:Apc	UTSW	18	34,314,463 (GRCm38)	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CCTCCAGTAGTGGTCAGGTATG -3'
(R):5'- ACATGATGCAGTACGGAGC -3'

Sequencing Primer
(F):5'- GAATATTTTCAAACTGACAAGTCCTG -3'
(R):5'- CGGAGCTTTTTATTTATAAGCATCAG -3'

Posted On

2017-07-14