Incidental Mutation 'R6081:Afg3l2'
ID 482935
Institutional Source Beutler Lab
Gene Symbol Afg3l2
Ensembl Gene ENSMUSG00000024527
Gene Name AFG3-like AAA ATPase 2
Synonyms Emv66, 2310036I02Rik, par
MMRRC Submission 044240-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6081 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 67537834-67582242 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 67554329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Methionine at position 458 (L458M)
Ref Sequence ENSEMBL: ENSMUSP00000025408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025408]
AlphaFold Q8JZQ2
Predicted Effect probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

DomainStartEndE-ValueType
low complexity region 95 121 N/A INTRINSIC
Pfam:FtsH_ext 144 241 8.8e-12 PFAM
transmembrane domain 251 270 N/A INTRINSIC
low complexity region 271 286 N/A INTRINSIC
AAA 339 478 1.37e-23 SMART
Pfam:Peptidase_M41 540 743 4e-77 PFAM
low complexity region 780 794 N/A INTRINSIC
Meta Mutation Damage Score 0.3865 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A T 5: 109,887,097 (GRCm39) M33K probably damaging Het
4930556J24Rik T C 11: 3,888,140 (GRCm39) Q82R unknown Het
Adcy9 T C 16: 4,112,545 (GRCm39) D714G probably benign Het
Ahctf1 G T 1: 179,609,237 (GRCm39) A639E probably benign Het
Ank3 G A 10: 69,838,395 (GRCm39) R1566K possibly damaging Het
Anxa5 C T 3: 36,519,436 (GRCm39) D18N probably damaging Het
Apc C T 18: 34,423,164 (GRCm39) P299L possibly damaging Het
Btnl4 C A 17: 34,693,210 (GRCm39) W68C probably damaging Het
Cmya5 T A 13: 93,281,021 (GRCm39) probably benign Het
Cstf2t G T 19: 31,060,523 (GRCm39) V20L probably benign Het
D630045J12Rik A T 6: 38,119,633 (GRCm39) V1703E probably damaging Het
Dhx32 A G 7: 133,323,941 (GRCm39) F535S probably damaging Het
Diras2 T C 13: 52,662,181 (GRCm39) D42G probably damaging Het
Dppa3 T A 6: 122,606,931 (GRCm39) D140E probably damaging Het
Gpr180 C T 14: 118,391,086 (GRCm39) T205I probably benign Het
Gzme T G 14: 56,355,764 (GRCm39) T183P possibly damaging Het
H2-T23 T A 17: 36,342,707 (GRCm39) I144F possibly damaging Het
Hlx T C 1: 184,459,894 (GRCm39) S415G probably benign Het
Krtap5-3 G A 7: 141,755,223 (GRCm39) C20Y unknown Het
Mcm8 G T 2: 132,670,003 (GRCm39) R359L probably benign Het
Mroh2b G C 15: 4,973,859 (GRCm39) E1126Q probably damaging Het
Nav1 C T 1: 135,398,560 (GRCm39) R674H probably damaging Het
Otx1 A T 11: 21,949,406 (GRCm39) L24H probably damaging Het
Rnaset2b T A 17: 7,256,193 (GRCm39) probably null Het
Samd12 T C 15: 53,583,074 (GRCm39) K87E probably benign Het
Sec16b T C 1: 157,388,324 (GRCm39) S564P probably benign Het
Speer4a1 A T 5: 26,239,960 (GRCm39) C263* probably null Het
Susd1 C A 4: 59,411,359 (GRCm39) C158F possibly damaging Het
Vmn2r6 C T 3: 64,463,953 (GRCm39) V294M probably benign Het
Other mutations in Afg3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Afg3l2 APN 18 67,564,723 (GRCm39) critical splice donor site probably null
IGL01395:Afg3l2 APN 18 67,575,880 (GRCm39) missense probably benign 0.21
IGL01533:Afg3l2 APN 18 67,538,488 (GRCm39) nonsense probably null
IGL01814:Afg3l2 APN 18 67,538,544 (GRCm39) missense probably benign 0.23
IGL01868:Afg3l2 APN 18 67,547,218 (GRCm39) missense possibly damaging 0.83
IGL02399:Afg3l2 APN 18 67,562,110 (GRCm39) missense possibly damaging 0.82
IGL02827:Afg3l2 APN 18 67,559,015 (GRCm39) missense probably damaging 1.00
IGL03342:Afg3l2 APN 18 67,540,390 (GRCm39) missense probably benign
IGL03392:Afg3l2 APN 18 67,547,139 (GRCm39) splice site probably benign
radicle UTSW 18 67,556,023 (GRCm39) missense probably damaging 1.00
rootlet UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R0057:Afg3l2 UTSW 18 67,556,156 (GRCm39) missense probably damaging 1.00
R0107:Afg3l2 UTSW 18 67,564,836 (GRCm39) missense probably damaging 1.00
R0650:Afg3l2 UTSW 18 67,548,627 (GRCm39) missense possibly damaging 0.77
R0831:Afg3l2 UTSW 18 67,554,297 (GRCm39) missense probably damaging 1.00
R0899:Afg3l2 UTSW 18 67,556,047 (GRCm39) missense possibly damaging 0.65
R0962:Afg3l2 UTSW 18 67,538,497 (GRCm39) missense possibly damaging 0.77
R1672:Afg3l2 UTSW 18 67,540,493 (GRCm39) missense probably benign 0.31
R1815:Afg3l2 UTSW 18 67,548,643 (GRCm39) nonsense probably null
R1838:Afg3l2 UTSW 18 67,547,242 (GRCm39) missense probably damaging 0.99
R2013:Afg3l2 UTSW 18 67,564,842 (GRCm39) missense probably damaging 0.99
R2383:Afg3l2 UTSW 18 67,556,026 (GRCm39) missense possibly damaging 0.91
R2906:Afg3l2 UTSW 18 67,573,292 (GRCm39) missense probably damaging 1.00
R4763:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R4765:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R4775:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5193:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5196:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5197:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5257:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5361:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5362:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5363:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5397:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5588:Afg3l2 UTSW 18 67,573,277 (GRCm39) missense possibly damaging 0.88
R5605:Afg3l2 UTSW 18 67,575,425 (GRCm39) nonsense probably null
R5696:Afg3l2 UTSW 18 67,540,529 (GRCm39) missense probably damaging 1.00
R5722:Afg3l2 UTSW 18 67,573,269 (GRCm39) missense probably benign 0.44
R5779:Afg3l2 UTSW 18 67,573,513 (GRCm39) missense probably null 0.12
R5972:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5973:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5974:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5979:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R5994:Afg3l2 UTSW 18 67,562,140 (GRCm39) missense probably damaging 1.00
R6026:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6027:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6028:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6029:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6033:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6035:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6075:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6077:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6131:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6132:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6134:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6152:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6154:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6169:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6178:Afg3l2 UTSW 18 67,542,598 (GRCm39) missense possibly damaging 0.91
R6187:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6216:Afg3l2 UTSW 18 67,554,329 (GRCm39) missense probably damaging 1.00
R6718:Afg3l2 UTSW 18 67,554,346 (GRCm39) missense probably damaging 1.00
R7388:Afg3l2 UTSW 18 67,556,023 (GRCm39) missense probably damaging 1.00
R8479:Afg3l2 UTSW 18 67,581,986 (GRCm39) missense probably benign 0.05
R8531:Afg3l2 UTSW 18 67,540,439 (GRCm39) missense probably damaging 0.99
R9017:Afg3l2 UTSW 18 67,542,550 (GRCm39) missense possibly damaging 0.81
R9220:Afg3l2 UTSW 18 67,562,266 (GRCm39) missense probably benign
R9222:Afg3l2 UTSW 18 67,567,257 (GRCm39) missense probably benign 0.05
R9371:Afg3l2 UTSW 18 67,567,262 (GRCm39) missense possibly damaging 0.84
R9381:Afg3l2 UTSW 18 67,575,451 (GRCm39) missense probably damaging 1.00
R9562:Afg3l2 UTSW 18 67,554,365 (GRCm39) missense probably damaging 1.00
Z1176:Afg3l2 UTSW 18 67,564,777 (GRCm39) missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GCACTGTCCAGCTTCAATGG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'
Posted On 2017-07-14