Mutagenetix > Incidental Mutations

Incidental Mutation 'R6057:Sptlc3'

482948

Institutional Source

Beutler Lab

Gene Symbol

Sptlc3

Ensembl Gene

ENSMUSG00000039092

Gene Name

serine palmitoyltransferase, long chain base subunit 3

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R6057 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

139493913-139637674 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139581613 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 309 (V309D)

Ref Sequence

ENSEMBL: ENSMUSP00000105710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]

AlphaFold

Q8BG54

Predicted Effect

probably damaging
Transcript: ENSMUST00000047370
AA Change: V309D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: V309D

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110083
AA Change: V309D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: V309D

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134801

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	A	G	6: 52,179,520		probably benign	Het
Acan	A	G	7: 79,099,782	S11G	probably null	Het
Ankrd13d	A	C	19: 4,282,228	V56G	probably damaging	Het
Arl15	A	G	13: 113,967,615	Y76C	probably damaging	Het
Aspg	G	A	12: 112,120,998	C296Y	probably damaging	Het
Astl	T	A	2: 127,345,969	D101E	probably benign	Het
Bmpr2	A	G	1: 59,842,818	N202S	probably benign	Het
Borcs7	T	C	19: 46,701,564	*106Q	probably null	Het
Brip1	A	G	11: 86,065,039	S883P	possibly damaging	Het
Cacng2	A	T	15: 78,118,791	L34Q	probably damaging	Het
Catip	A	C	1: 74,362,918	D84A	probably damaging	Het
Ccdc162	A	G	10: 41,634,041	L856S	possibly damaging	Het
Ccdc38	A	G	10: 93,581,746	K500E	probably damaging	Het
Ccser2	T	C	14: 36,941,165	K21E	probably damaging	Het
Cd93	A	T	2: 148,441,519	Y636N	probably damaging	Het
Cep128	A	T	12: 91,296,224	N300K	possibly damaging	Het
Cfap44	A	G	16: 44,449,097	T1155A	probably benign	Het
Clec16a	T	C	16: 10,630,087	L550P	probably damaging	Het
Csmd3	T	C	15: 47,755,391	Y1867C	probably damaging	Het
Cul3	A	T	1: 80,271,532	I674N	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp2d34	T	C	15: 82,616,351	H429R	probably benign	Het
Dab2ip	T	A	2: 35,692,255	C4*	probably null	Het
Dcaf1	A	G	9: 106,854,247	E641G	probably damaging	Het
Dda1	T	A	8: 71,474,632		probably benign	Het
Dmgdh	C	T	13: 93,752,452	T866I	probably benign	Het
Ect2l	T	C	10: 18,161,502	T383A	probably benign	Het
Ets2	A	G	16: 95,714,372	N181D	probably benign	Het
Ezh2	A	G	6: 47,552,423	F222L	probably damaging	Het
Frem3	T	C	8: 80,615,587	L1503P	probably damaging	Het
Fsip2	C	A	2: 82,979,433	A2032E	probably damaging	Het
Gm1818	C	T	12: 48,555,563		noncoding transcript	Het
Gm9493	A	G	19: 23,619,742	S1G	probably damaging	Het
Grin2b	A	G	6: 135,733,944	I868T	possibly damaging	Het
Ift22	A	T	5: 136,911,133	T17S	possibly damaging	Het
Il4ra	T	C	7: 125,571,563	W216R	probably damaging	Het
Kcnj6	A	T	16: 94,832,377	W274R	probably damaging	Het
Kctd19	G	A	8: 105,396,450	H111Y	probably damaging	Het
Kremen2	A	G	17: 23,742,705	V276A	probably benign	Het
Lig1	C	A	7: 13,288,672	Q143K	probably damaging	Het
Lrp1	A	T	10: 127,567,490	D2071E	probably damaging	Het
Macf1	C	T	4: 123,510,743	M475I	probably damaging	Het
Mbtd1	G	A	11: 93,929,659	A427T	probably damaging	Het
Myof	A	G	19: 37,926,981		probably null	Het
Nbeal2	T	C	9: 110,641,877	D308G	possibly damaging	Het
Ncdn	T	C	4: 126,745,031	Q665R	probably benign	Het
Nkd1	T	C	8: 88,589,814		probably null	Het
Nktr	G	A	9: 121,748,389		probably benign	Het
Npc1l1	A	T	11: 6,217,806	M995K	possibly damaging	Het
Olfr1129	C	A	2: 87,576,019	R312S	probably benign	Het
Olfr300-ps1	T	A	7: 86,443,189	C69*	probably null	Het
Olfr740	A	T	14: 50,453,744	R231*	probably null	Het
Padi4	T	C	4: 140,760,040	T184A	probably damaging	Het
Pgm2l1	C	T	7: 100,266,674	P409S	probably benign	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pgr	T	C	9: 8,902,005	L513P	probably damaging	Het
Pikfyve	T	A	1: 65,272,571	I1989N	probably damaging	Het
Prrc2a	T	C	17: 35,152,740	T1806A	probably benign	Het
Psd	T	C	19: 46,323,314	E309G	possibly damaging	Het
Qtrt1	C	T	9: 21,412,003	T50I	probably damaging	Het
Rims2	A	C	15: 39,675,020	T1320P	probably damaging	Het
Scn11a	T	G	9: 119,765,448	N1293T	probably damaging	Het
Scn8a	T	C	15: 100,974,667	F529S	possibly damaging	Het
Sec14l4	A	T	11: 4,035,142	D25V	possibly damaging	Het
Sema3a	C	T	5: 13,565,865	R419C	probably damaging	Het
Slc12a1	T	C	2: 125,190,213	Y595H	probably damaging	Het
Slc25a28	A	T	19: 43,666,925	H170Q	possibly damaging	Het
Slc26a1	T	A	5: 108,673,765	Q86L	probably damaging	Het
Slc48a1	T	A	15: 97,789,917	W51R	probably damaging	Het
Srcap	G	A	7: 127,541,356	S1375N	probably damaging	Het
Tanc1	C	A	2: 59,817,493	H986Q	possibly damaging	Het
Tbc1d4	A	G	14: 101,489,917	V486A	probably damaging	Het
Tceanc2	T	C	4: 107,147,579	D124G	probably damaging	Het
Tdrd9	A	G	12: 112,013,286	M402V	possibly damaging	Het
Tmem132d	T	C	5: 127,784,870	D729G	probably damaging	Het
Tmem62	T	A	2: 120,977,462	I55N	probably damaging	Het
Tnfrsf21	A	T	17: 43,039,715	N257Y	possibly damaging	Het
Trappc3	T	C	4: 126,274,041	L131P	probably damaging	Het
Vmn2r25	A	T	6: 123,822,941	M814K	possibly damaging	Het
Vmn2r87	T	C	10: 130,472,357	I671V	probably benign	Het
Vwa8	A	T	14: 79,082,873	D1108V	probably benign	Het
Xrcc4	C	G	13: 89,991,079	A241P	possibly damaging	Het
Xylt1	T	A	7: 117,591,908	D310E	probably benign	Het
Zfp27	T	G	7: 29,895,019	H507P	possibly damaging	Het
Zfp341	C	T	2: 154,625,034	P108S	probably benign	Het
Zfp641	T	C	15: 98,292,935	N76S	probably benign	Het
Zfp936	T	C	7: 43,190,363	V418A	probably benign	Het

Other mutations in Sptlc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01392:Sptlc3	APN	2	139546421	missense	possibly damaging	0.55
IGL01537:Sptlc3	APN	2	139589695	missense	possibly damaging	0.95
IGL01996:Sptlc3	APN	2	139581504	splice site	probably benign
IGL02512:Sptlc3	APN	2	139547203	missense	probably damaging	1.00
IGL03278:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
IGL03286:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
R0266:Sptlc3	UTSW	2	139596037	missense	possibly damaging	0.93
R0362:Sptlc3	UTSW	2	139546555	splice site	probably benign
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1494:Sptlc3	UTSW	2	139589560	missense	possibly damaging	0.58
R1847:Sptlc3	UTSW	2	139625923	missense	probably benign	0.08
R1919:Sptlc3	UTSW	2	139566675	missense	possibly damaging	0.66
R2093:Sptlc3	UTSW	2	139625874	missense	possibly damaging	0.89
R2396:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R2972:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2973:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2974:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R4601:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4602:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4610:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4745:Sptlc3	UTSW	2	139547167	missense	probably damaging	1.00
R4779:Sptlc3	UTSW	2	139589589	missense	probably benign	0.04
R4992:Sptlc3	UTSW	2	139596003	missense	probably benign	0.04
R5162:Sptlc3	UTSW	2	139631343	missense	probably benign	0.11
R5401:Sptlc3	UTSW	2	139636723	missense	possibly damaging	0.75
R5406:Sptlc3	UTSW	2	139546478	missense	probably benign	0.26
R5642:Sptlc3	UTSW	2	139546408	missense	probably damaging	0.96
R5840:Sptlc3	UTSW	2	139547206	missense	probably damaging	1.00
R6376:Sptlc3	UTSW	2	139636772	missense	probably benign	0.21
R6852:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R7026:Sptlc3	UTSW	2	139537688	missense	probably benign
R7412:Sptlc3	UTSW	2	139589617	missense	possibly damaging	0.75
R7516:Sptlc3	UTSW	2	139589518	missense	probably benign	0.11
R7733:Sptlc3	UTSW	2	139631368	missense	possibly damaging	0.77
R7826:Sptlc3	UTSW	2	139547195	missense	probably benign	0.44
R7949:Sptlc3	UTSW	2	139625875	missense	possibly damaging	0.81
R9224:Sptlc3	UTSW	2	139494234	missense	probably benign	0.17
R9237:Sptlc3	UTSW	2	139566685	missense	probably benign	0.40
R9319:Sptlc3	UTSW	2	139636810	missense	possibly damaging	0.65
R9330:Sptlc3	UTSW	2	139546503	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TCAAAGTCCAGGCCTGAGTG -3'
(R):5'- TACTCTCCAGACAAGAGGATGGG -3'

Posted On

2017-07-14