Mutagenetix > Incidental Mutations

Incidental Mutation 'R6057:Grin2b'

482963

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6057 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135733944 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 868 (I868T)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053880
AA Change: I868T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: I868T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111905
AA Change: I868T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: I868T

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136027

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	A	G	6: 52,179,520		probably benign	Het
Acan	A	G	7: 79,099,782	S11G	probably null	Het
Ankrd13d	A	C	19: 4,282,228	V56G	probably damaging	Het
Arl15	A	G	13: 113,967,615	Y76C	probably damaging	Het
Aspg	G	A	12: 112,120,998	C296Y	probably damaging	Het
Astl	T	A	2: 127,345,969	D101E	probably benign	Het
Bmpr2	A	G	1: 59,842,818	N202S	probably benign	Het
Borcs7	T	C	19: 46,701,564	*106Q	probably null	Het
Brip1	A	G	11: 86,065,039	S883P	possibly damaging	Het
Cacng2	A	T	15: 78,118,791	L34Q	probably damaging	Het
Catip	A	C	1: 74,362,918	D84A	probably damaging	Het
Ccdc162	A	G	10: 41,634,041	L856S	possibly damaging	Het
Ccdc38	A	G	10: 93,581,746	K500E	probably damaging	Het
Ccser2	T	C	14: 36,941,165	K21E	probably damaging	Het
Cd93	A	T	2: 148,441,519	Y636N	probably damaging	Het
Cep128	A	T	12: 91,296,224	N300K	possibly damaging	Het
Cfap44	A	G	16: 44,449,097	T1155A	probably benign	Het
Clec16a	T	C	16: 10,630,087	L550P	probably damaging	Het
Csmd3	T	C	15: 47,755,391	Y1867C	probably damaging	Het
Cul3	A	T	1: 80,271,532	I674N	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp2d34	T	C	15: 82,616,351	H429R	probably benign	Het
Dab2ip	T	A	2: 35,692,255	C4*	probably null	Het
Dcaf1	A	G	9: 106,854,247	E641G	probably damaging	Het
Dda1	T	A	8: 71,474,632		probably benign	Het
Dmgdh	C	T	13: 93,752,452	T866I	probably benign	Het
Ect2l	T	C	10: 18,161,502	T383A	probably benign	Het
Ets2	A	G	16: 95,714,372	N181D	probably benign	Het
Ezh2	A	G	6: 47,552,423	F222L	probably damaging	Het
Frem3	T	C	8: 80,615,587	L1503P	probably damaging	Het
Fsip2	C	A	2: 82,979,433	A2032E	probably damaging	Het
Gm1818	C	T	12: 48,555,563		noncoding transcript	Het
Gm9493	A	G	19: 23,619,742	S1G	probably damaging	Het
Ift22	A	T	5: 136,911,133	T17S	possibly damaging	Het
Il4ra	T	C	7: 125,571,563	W216R	probably damaging	Het
Kcnj6	A	T	16: 94,832,377	W274R	probably damaging	Het
Kctd19	G	A	8: 105,396,450	H111Y	probably damaging	Het
Kremen2	A	G	17: 23,742,705	V276A	probably benign	Het
Lig1	C	A	7: 13,288,672	Q143K	probably damaging	Het
Lrp1	A	T	10: 127,567,490	D2071E	probably damaging	Het
Macf1	C	T	4: 123,510,743	M475I	probably damaging	Het
Mbtd1	G	A	11: 93,929,659	A427T	probably damaging	Het
Myof	A	G	19: 37,926,981		probably null	Het
Nbeal2	T	C	9: 110,641,877	D308G	possibly damaging	Het
Ncdn	T	C	4: 126,745,031	Q665R	probably benign	Het
Nkd1	T	C	8: 88,589,814		probably null	Het
Nktr	G	A	9: 121,748,389		probably benign	Het
Npc1l1	A	T	11: 6,217,806	M995K	possibly damaging	Het
Olfr1129	C	A	2: 87,576,019	R312S	probably benign	Het
Olfr300-ps1	T	A	7: 86,443,189	C69*	probably null	Het
Olfr740	A	T	14: 50,453,744	R231*	probably null	Het
Padi4	T	C	4: 140,760,040	T184A	probably damaging	Het
Pgm2l1	C	T	7: 100,266,674	P409S	probably benign	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pgr	T	C	9: 8,902,005	L513P	probably damaging	Het
Pikfyve	T	A	1: 65,272,571	I1989N	probably damaging	Het
Prrc2a	T	C	17: 35,152,740	T1806A	probably benign	Het
Psd	T	C	19: 46,323,314	E309G	possibly damaging	Het
Qtrt1	C	T	9: 21,412,003	T50I	probably damaging	Het
Rims2	A	C	15: 39,675,020	T1320P	probably damaging	Het
Scn11a	T	G	9: 119,765,448	N1293T	probably damaging	Het
Scn8a	T	C	15: 100,974,667	F529S	possibly damaging	Het
Sec14l4	A	T	11: 4,035,142	D25V	possibly damaging	Het
Sema3a	C	T	5: 13,565,865	R419C	probably damaging	Het
Slc12a1	T	C	2: 125,190,213	Y595H	probably damaging	Het
Slc25a28	A	T	19: 43,666,925	H170Q	possibly damaging	Het
Slc26a1	T	A	5: 108,673,765	Q86L	probably damaging	Het
Slc48a1	T	A	15: 97,789,917	W51R	probably damaging	Het
Sptlc3	T	A	2: 139,581,613	V309D	probably damaging	Het
Srcap	G	A	7: 127,541,356	S1375N	probably damaging	Het
Tanc1	C	A	2: 59,817,493	H986Q	possibly damaging	Het
Tbc1d4	A	G	14: 101,489,917	V486A	probably damaging	Het
Tceanc2	T	C	4: 107,147,579	D124G	probably damaging	Het
Tdrd9	A	G	12: 112,013,286	M402V	possibly damaging	Het
Tmem132d	T	C	5: 127,784,870	D729G	probably damaging	Het
Tmem62	T	A	2: 120,977,462	I55N	probably damaging	Het
Tnfrsf21	A	T	17: 43,039,715	N257Y	possibly damaging	Het
Trappc3	T	C	4: 126,274,041	L131P	probably damaging	Het
Vmn2r25	A	T	6: 123,822,941	M814K	possibly damaging	Het
Vmn2r87	T	C	10: 130,472,357	I671V	probably benign	Het
Vwa8	A	T	14: 79,082,873	D1108V	probably benign	Het
Xrcc4	C	G	13: 89,991,079	A241P	possibly damaging	Het
Xylt1	T	A	7: 117,591,908	D310E	probably benign	Het
Zfp27	T	G	7: 29,895,019	H507P	possibly damaging	Het
Zfp341	C	T	2: 154,625,034	P108S	probably benign	Het
Zfp641	T	C	15: 98,292,935	N76S	probably benign	Het
Zfp936	T	C	7: 43,190,363	V418A	probably benign	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATAGACAGAGGACTCACGGC -3'
(R):5'- GCTCATGAAATGAAGTTGGCTG -3'

Posted On

2017-07-14