Incidental Mutation 'R6057:Pgpep1'
ID482973
Institutional Source Beutler Lab
Gene Symbol Pgpep1
Ensembl Gene ENSMUSG00000056204
Gene Namepyroglutamyl-peptidase I
SynonymsPcp, 2810003H13Rik, PGP-I
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6057 (G1)
Quality Score187.009
Status Not validated
Chromosome8
Chromosomal Location70646435-70660388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70652451 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 53 (T53M)
Ref Sequence ENSEMBL: ENSMUSP00000148119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070173] [ENSMUST00000209768] [ENSMUST00000210193] [ENSMUST00000210307] [ENSMUST00000211715]
Predicted Effect probably damaging
Transcript: ENSMUST00000070173
AA Change: T53M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000070778
Gene: ENSMUSG00000056204
AA Change: T53M

DomainStartEndE-ValueType
Pfam:Peptidase_C15 6 185 1.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209768
Predicted Effect probably benign
Transcript: ENSMUST00000210193
Predicted Effect probably benign
Transcript: ENSMUST00000210307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210459
Predicted Effect probably benign
Transcript: ENSMUST00000210786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211526
Predicted Effect probably damaging
Transcript: ENSMUST00000211715
AA Change: T53M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a cysteine protease and member of the peptidase C15 family of proteins. The encoded protein cleaves amino terminal pyroglutamate residues from protein substrates including thyrotropin-releasing hormone and other neuropeptides. Expression of this gene may be downregulated in colorectal cancer, while activity of the encoded protein may be negatively correlated with cancer progression in colorectal cancer patients. Activity of the encoded protease may also be altered in other disease states including in liver cirrhosis, which is associated with reduced protease activity, and in necrozoospermia, which is associated with elevated protease activity. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cul3 A T 1: 80,271,532 I674N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Dmgdh C T 13: 93,752,452 T866I probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Ezh2 A G 6: 47,552,423 F222L probably damaging Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Mbtd1 G A 11: 93,929,659 A427T probably damaging Het
Myof A G 19: 37,926,981 probably null Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Psd T C 19: 46,323,314 E309G possibly damaging Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tbc1d4 A G 14: 101,489,917 V486A probably damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem132d T C 5: 127,784,870 D729G probably damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Vwa8 A T 14: 79,082,873 D1108V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Pgpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Pgpep1 APN 8 70652469 missense probably damaging 1.00
R0365:Pgpep1 UTSW 8 70652524 splice site probably null
R0413:Pgpep1 UTSW 8 70657450 missense probably damaging 1.00
R0603:Pgpep1 UTSW 8 70650633 missense probably benign 0.03
R5547:Pgpep1 UTSW 8 70652419 missense probably benign 0.00
R5773:Pgpep1 UTSW 8 70652451 missense probably damaging 1.00
R5775:Pgpep1 UTSW 8 70652451 missense probably damaging 1.00
R6056:Pgpep1 UTSW 8 70652451 missense probably damaging 1.00
R6573:Pgpep1 UTSW 8 70650615 missense probably benign 0.00
R7544:Pgpep1 UTSW 8 70650518 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGGGCCCTGTAAGGTGTG -3'
(R):5'- GGTTATGTGAAGTCAAGACTCCG -3'

Posted On2017-07-14