Mutagenetix > Incidental Mutation

Incidental Mutation 'R6057:Frem3'

482975

Institutional Source

Beutler Lab

Gene Symbol

Frem3

Ensembl Gene

ENSMUSG00000042353

Gene Name

Fras1 related extracellular matrix protein 3

Synonyms

LOC333315

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R6057 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

80611080-80695356 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80615587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1503 (L1503P)

Ref Sequence

ENSEMBL: ENSMUSP00000038015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039695]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039695
AA Change: L1503P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: L1503P

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:Cadherin_3	369	515	9.5e-31	PFAM
Pfam:Cadherin_3	495	596	9.4e-20	PFAM
Pfam:Cadherin_3	637	786	4.2e-20	PFAM
Pfam:Cadherin_3	788	913	5.5e-23	PFAM
Pfam:Cadherin_3	998	1163	1.8e-20	PFAM
Pfam:Cadherin_3	1129	1254	1.3e-19	PFAM
Pfam:Cadherin_3	1250	1395	9.5e-34	PFAM
Pfam:Cadherin_3	1397	1508	2.7e-21	PFAM
Pfam:Cadherin_3	1493	1617	1.2e-27	PFAM
Pfam:Cadherin_3	1622	1748	4.8e-17	PFAM
Calx_beta	1754	1853	1.45e-7	SMART
Calx_beta	1866	1977	3.35e-12	SMART
Calx_beta	1991	2098	1.61e-5	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	A	G	6: 52,179,520		probably benign	Het
Acan	A	G	7: 79,099,782	S11G	probably null	Het
Ankrd13d	A	C	19: 4,282,228	V56G	probably damaging	Het
Arl15	A	G	13: 113,967,615	Y76C	probably damaging	Het
Aspg	G	A	12: 112,120,998	C296Y	probably damaging	Het
Astl	T	A	2: 127,345,969	D101E	probably benign	Het
Bmpr2	A	G	1: 59,842,818	N202S	probably benign	Het
Borcs7	T	C	19: 46,701,564	*106Q	probably null	Het
Brip1	A	G	11: 86,065,039	S883P	possibly damaging	Het
Cacng2	A	T	15: 78,118,791	L34Q	probably damaging	Het
Catip	A	C	1: 74,362,918	D84A	probably damaging	Het
Ccdc162	A	G	10: 41,634,041	L856S	possibly damaging	Het
Ccdc38	A	G	10: 93,581,746	K500E	probably damaging	Het
Ccser2	T	C	14: 36,941,165	K21E	probably damaging	Het
Cd93	A	T	2: 148,441,519	Y636N	probably damaging	Het
Cep128	A	T	12: 91,296,224	N300K	possibly damaging	Het
Cfap44	A	G	16: 44,449,097	T1155A	probably benign	Het
Clec16a	T	C	16: 10,630,087	L550P	probably damaging	Het
Csmd3	T	C	15: 47,755,391	Y1867C	probably damaging	Het
Cul3	A	T	1: 80,271,532	I674N	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp2d34	T	C	15: 82,616,351	H429R	probably benign	Het
Dab2ip	T	A	2: 35,692,255	C4*	probably null	Het
Dcaf1	A	G	9: 106,854,247	E641G	probably damaging	Het
Dda1	T	A	8: 71,474,632		probably benign	Het
Dmgdh	C	T	13: 93,752,452	T866I	probably benign	Het
Ect2l	T	C	10: 18,161,502	T383A	probably benign	Het
Ets2	A	G	16: 95,714,372	N181D	probably benign	Het
Ezh2	A	G	6: 47,552,423	F222L	probably damaging	Het
Fsip2	C	A	2: 82,979,433	A2032E	probably damaging	Het
Gm1818	C	T	12: 48,555,563		noncoding transcript	Het
Gm9493	A	G	19: 23,619,742	S1G	probably damaging	Het
Grin2b	A	G	6: 135,733,944	I868T	possibly damaging	Het
Ift22	A	T	5: 136,911,133	T17S	possibly damaging	Het
Il4ra	T	C	7: 125,571,563	W216R	probably damaging	Het
Kcnj6	A	T	16: 94,832,377	W274R	probably damaging	Het
Kctd19	G	A	8: 105,396,450	H111Y	probably damaging	Het
Kremen2	A	G	17: 23,742,705	V276A	probably benign	Het
Lig1	C	A	7: 13,288,672	Q143K	probably damaging	Het
Lrp1	A	T	10: 127,567,490	D2071E	probably damaging	Het
Macf1	C	T	4: 123,510,743	M475I	probably damaging	Het
Mbtd1	G	A	11: 93,929,659	A427T	probably damaging	Het
Myof	A	G	19: 37,926,981		probably null	Het
Nbeal2	T	C	9: 110,641,877	D308G	possibly damaging	Het
Ncdn	T	C	4: 126,745,031	Q665R	probably benign	Het
Nkd1	T	C	8: 88,589,814		probably null	Het
Nktr	G	A	9: 121,748,389		probably benign	Het
Npc1l1	A	T	11: 6,217,806	M995K	possibly damaging	Het
Olfr1129	C	A	2: 87,576,019	R312S	probably benign	Het
Olfr300-ps1	T	A	7: 86,443,189	C69*	probably null	Het
Olfr740	A	T	14: 50,453,744	R231*	probably null	Het
Padi4	T	C	4: 140,760,040	T184A	probably damaging	Het
Pgm2l1	C	T	7: 100,266,674	P409S	probably benign	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pgr	T	C	9: 8,902,005	L513P	probably damaging	Het
Pikfyve	T	A	1: 65,272,571	I1989N	probably damaging	Het
Prrc2a	T	C	17: 35,152,740	T1806A	probably benign	Het
Psd	T	C	19: 46,323,314	E309G	possibly damaging	Het
Qtrt1	C	T	9: 21,412,003	T50I	probably damaging	Het
Rims2	A	C	15: 39,675,020	T1320P	probably damaging	Het
Scn11a	T	G	9: 119,765,448	N1293T	probably damaging	Het
Scn8a	T	C	15: 100,974,667	F529S	possibly damaging	Het
Sec14l4	A	T	11: 4,035,142	D25V	possibly damaging	Het
Sema3a	C	T	5: 13,565,865	R419C	probably damaging	Het
Slc12a1	T	C	2: 125,190,213	Y595H	probably damaging	Het
Slc25a28	A	T	19: 43,666,925	H170Q	possibly damaging	Het
Slc26a1	T	A	5: 108,673,765	Q86L	probably damaging	Het
Slc48a1	T	A	15: 97,789,917	W51R	probably damaging	Het
Sptlc3	T	A	2: 139,581,613	V309D	probably damaging	Het
Srcap	G	A	7: 127,541,356	S1375N	probably damaging	Het
Tanc1	C	A	2: 59,817,493	H986Q	possibly damaging	Het
Tbc1d4	A	G	14: 101,489,917	V486A	probably damaging	Het
Tceanc2	T	C	4: 107,147,579	D124G	probably damaging	Het
Tdrd9	A	G	12: 112,013,286	M402V	possibly damaging	Het
Tmem132d	T	C	5: 127,784,870	D729G	probably damaging	Het
Tmem62	T	A	2: 120,977,462	I55N	probably damaging	Het
Tnfrsf21	A	T	17: 43,039,715	N257Y	possibly damaging	Het
Trappc3	T	C	4: 126,274,041	L131P	probably damaging	Het
Vmn2r25	A	T	6: 123,822,941	M814K	possibly damaging	Het
Vmn2r87	T	C	10: 130,472,357	I671V	probably benign	Het
Vwa8	A	T	14: 79,082,873	D1108V	probably benign	Het
Xrcc4	C	G	13: 89,991,079	A241P	possibly damaging	Het
Xylt1	T	A	7: 117,591,908	D310E	probably benign	Het
Zfp27	T	G	7: 29,895,019	H507P	possibly damaging	Het
Zfp341	C	T	2: 154,625,034	P108S	probably benign	Het
Zfp641	T	C	15: 98,292,935	N76S	probably benign	Het
Zfp936	T	C	7: 43,190,363	V418A	probably benign	Het

Other mutations in Frem3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Frem3	APN	8	80668810	missense	possibly damaging	0.75
IGL01019:Frem3	APN	8	80615134	missense	probably benign	0.02
IGL01470:Frem3	APN	8	80614315	missense	probably damaging	1.00
IGL01609:Frem3	APN	8	80612704	missense	probably benign	0.00
IGL01622:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01623:Frem3	APN	8	80613915	missense	probably benign	0.01
IGL01751:Frem3	APN	8	80615743	missense	probably benign	0.33
IGL02037:Frem3	APN	8	80611489	missense	probably benign	0.31
IGL02039:Frem3	APN	8	80612971	missense	probably damaging	1.00
IGL02084:Frem3	APN	8	80612443	missense	possibly damaging	0.95
IGL02124:Frem3	APN	8	80613094	missense	probably damaging	0.99
IGL02140:Frem3	APN	8	80614107	missense	possibly damaging	0.84
IGL02836:Frem3	APN	8	80614381	missense	probably benign
IGL03090:Frem3	APN	8	80618229	missense	probably benign	0.01
IGL03102:Frem3	APN	8	80613032	missense	possibly damaging	0.92
IGL03116:Frem3	APN	8	80612806	missense	possibly damaging	0.84
IGL03165:Frem3	APN	8	80612529	missense	probably benign	0.26
IGL03224:Frem3	APN	8	80613463	missense	probably damaging	1.00
IGL03401:Frem3	APN	8	80614541	missense	probably damaging	1.00
IGL03403:Frem3	APN	8	80611090	missense	probably benign	0.04
FR4340:Frem3	UTSW	8	80615241	small insertion	probably benign
FR4976:Frem3	UTSW	8	80615241	small insertion	probably benign
IGL02991:Frem3	UTSW	8	80668882	missense	probably damaging	1.00
IGL03052:Frem3	UTSW	8	80614530	missense	probably damaging	1.00
R0089:Frem3	UTSW	8	80615878	missense	possibly damaging	0.94
R0647:Frem3	UTSW	8	80615185	missense	probably damaging	1.00
R0690:Frem3	UTSW	8	80613952	missense	possibly damaging	0.84
R0766:Frem3	UTSW	8	80615322	missense	probably benign
R0834:Frem3	UTSW	8	80687008	missense	probably damaging	1.00
R0909:Frem3	UTSW	8	80663406	missense	probably benign	0.45
R1033:Frem3	UTSW	8	80695157	missense	probably benign	0.00
R1144:Frem3	UTSW	8	80611884	missense	probably benign	0.01
R1312:Frem3	UTSW	8	80615322	missense	probably benign
R1330:Frem3	UTSW	8	80668839	missense	probably damaging	0.99
R1355:Frem3	UTSW	8	80690702	missense	probably damaging	1.00
R1390:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R1413:Frem3	UTSW	8	80668801	missense	probably benign
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1470:Frem3	UTSW	8	80611191	missense	probably benign	0.05
R1503:Frem3	UTSW	8	80687018	missense	probably damaging	0.99
R1538:Frem3	UTSW	8	80612710	missense	probably damaging	1.00
R1538:Frem3	UTSW	8	80613135	missense	probably benign	0.00
R1612:Frem3	UTSW	8	80614861	missense	probably damaging	1.00
R1793:Frem3	UTSW	8	80613112	missense	probably benign	0.03
R1872:Frem3	UTSW	8	80612576	missense	probably damaging	1.00
R1879:Frem3	UTSW	8	80611938	nonsense	probably null
R1886:Frem3	UTSW	8	80613885	missense	probably benign	0.00
R1933:Frem3	UTSW	8	80612890	missense	probably benign	0.00
R2027:Frem3	UTSW	8	80695337	missense	possibly damaging	0.75
R2040:Frem3	UTSW	8	80615826	missense	possibly damaging	0.92
R2050:Frem3	UTSW	8	80614891	missense	probably damaging	1.00
R2079:Frem3	UTSW	8	80615103	missense	probably benign	0.03
R2099:Frem3	UTSW	8	80615859	missense	probably benign	0.06
R2120:Frem3	UTSW	8	80615457	missense	probably benign	0.20
R2842:Frem3	UTSW	8	80669349	splice site	probably null
R2845:Frem3	UTSW	8	80613220	missense	probably damaging	1.00
R3015:Frem3	UTSW	8	80690773	missense	probably damaging	0.99
R3442:Frem3	UTSW	8	80613040	missense	probably damaging	1.00
R3724:Frem3	UTSW	8	80615271	missense	probably benign	0.06
R3730:Frem3	UTSW	8	80615916	missense	probably damaging	0.99
R3939:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3940:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R3941:Frem3	UTSW	8	80615020	missense	possibly damaging	0.84
R4089:Frem3	UTSW	8	80615173	missense	probably damaging	1.00
R4282:Frem3	UTSW	8	80614141	missense	probably benign	0.00
R4437:Frem3	UTSW	8	80612607	missense	probably benign	0.30
R4480:Frem3	UTSW	8	80611357	missense	probably benign	0.10
R4575:Frem3	UTSW	8	80616075	missense	probably benign	0.17
R4583:Frem3	UTSW	8	80613514	missense	probably benign	0.03
R4620:Frem3	UTSW	8	80668957	missense	possibly damaging	0.82
R4621:Frem3	UTSW	8	80669191	splice site	probably null
R4644:Frem3	UTSW	8	80613727	missense	probably benign	0.33
R4667:Frem3	UTSW	8	80663420	missense	probably damaging	0.97
R4748:Frem3	UTSW	8	80611459	missense	probably damaging	1.00
R4823:Frem3	UTSW	8	80613958	missense	probably benign	0.25
R4836:Frem3	UTSW	8	80663397	missense	probably damaging	0.99
R4867:Frem3	UTSW	8	80613283	missense	probably damaging	1.00
R4921:Frem3	UTSW	8	80613136	missense	possibly damaging	0.83
R5030:Frem3	UTSW	8	80613247	missense	possibly damaging	0.89
R5035:Frem3	UTSW	8	80615914	missense	probably damaging	0.97
R5172:Frem3	UTSW	8	80612566	missense	probably benign	0.44
R5289:Frem3	UTSW	8	80612319	missense	probably benign	0.00
R5492:Frem3	UTSW	8	80612677	missense	probably damaging	1.00
R5655:Frem3	UTSW	8	80612694	missense	probably benign	0.00
R5685:Frem3	UTSW	8	80695303	missense	probably damaging	1.00
R5723:Frem3	UTSW	8	80613397	missense	probably benign	0.02
R5743:Frem3	UTSW	8	80615778	missense	probably damaging	0.98
R5889:Frem3	UTSW	8	80614288	missense	probably damaging	1.00
R6048:Frem3	UTSW	8	80613433	missense	probably benign	0.03
R6137:Frem3	UTSW	8	80615047	missense	probably benign
R6264:Frem3	UTSW	8	80615203	missense	probably damaging	1.00
R6339:Frem3	UTSW	8	80613015	missense	possibly damaging	0.84
R6418:Frem3	UTSW	8	80611152	missense	probably benign	0.08
R6680:Frem3	UTSW	8	80669320	missense	probably damaging	1.00
R6773:Frem3	UTSW	8	80611815	missense	probably damaging	1.00
R6838:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R6928:Frem3	UTSW	8	80611282	missense	possibly damaging	0.48
R6939:Frem3	UTSW	8	80615145	missense	probably benign	0.23
R6995:Frem3	UTSW	8	80612579	missense	probably damaging	0.98
R7112:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7155:Frem3	UTSW	8	80616039	missense	probably benign	0.01
R7235:Frem3	UTSW	8	80690725	missense	probably benign	0.00
R7282:Frem3	UTSW	8	80612031	missense	probably damaging	1.00
R7403:Frem3	UTSW	8	80616145	missense	probably damaging	1.00
R7422:Frem3	UTSW	8	80615763	missense	probably benign	0.00
R7485:Frem3	UTSW	8	80613336	missense	probably damaging	1.00
R7516:Frem3	UTSW	8	80612083	missense	probably damaging	0.99
R7858:Frem3	UTSW	8	80611721	nonsense	probably null
R7976:Frem3	UTSW	8	80611602	nonsense	probably null
R8171:Frem3	UTSW	8	80615240	missense	probably damaging	1.00
R8185:Frem3	UTSW	8	80612304	nonsense	probably null
R8306:Frem3	UTSW	8	80612211	missense	possibly damaging	0.95
R8478:Frem3	UTSW	8	80611558	missense	probably damaging	1.00
R8518:Frem3	UTSW	8	80612595	missense	probably damaging	1.00
R8794:Frem3	UTSW	8	80612278	missense	probably damaging	1.00
R8794:Frem3	UTSW	8	80616222	missense	probably benign	0.02
R8806:Frem3	UTSW	8	80663435	missense	probably benign	0.30
R8833:Frem3	UTSW	8	80612772	missense	probably benign	0.29
R8879:Frem3	UTSW	8	80613148	missense	probably damaging	0.98
R8897:Frem3	UTSW	8	80612790	missense	probably damaging	1.00
R8983:Frem3	UTSW	8	80669246	missense	probably damaging	1.00
R9207:Frem3	UTSW	8	80613442	missense	possibly damaging	0.73
R9277:Frem3	UTSW	8	80690773	missense	probably damaging	0.96
R9536:Frem3	UTSW	8	80615419	missense	probably benign	0.00
R9596:Frem3	UTSW	8	80615322	missense	probably benign
R9649:Frem3	UTSW	8	80614516	missense	probably damaging	1.00
R9671:Frem3	UTSW	8	80612505	missense	probably benign	0.00
R9723:Frem3	UTSW	8	80614723	missense	probably benign
R9790:Frem3	UTSW	8	80613261	missense	probably benign	0.01
R9791:Frem3	UTSW	8	80613261	missense	probably benign	0.01
RF030:Frem3	UTSW	8	80615238	small insertion	probably benign
RF034:Frem3	UTSW	8	80615238	small insertion	probably benign
RF042:Frem3	UTSW	8	80615238	small insertion	probably benign
X0024:Frem3	UTSW	8	80613081	missense	possibly damaging	0.76
X0027:Frem3	UTSW	8	80612388	nonsense	probably null
Z1088:Frem3	UTSW	8	80615426	missense	probably benign	0.04
Z1176:Frem3	UTSW	8	80611503	missense	probably damaging	0.99
Z1176:Frem3	UTSW	8	80615431	missense	probably benign	0.03
Z1177:Frem3	UTSW	8	80616129	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- AGAAGGTAACAGAATGACCCTC -3'
(R):5'- AGCTGGAGTGTCCTCATCTTC -3'

Posted On

2017-07-14