Incidental Mutation 'R6057:Scn11a'
ID 482982
Institutional Source Beutler Lab
Gene Symbol Scn11a
Ensembl Gene ENSMUSG00000034115
Gene Name sodium channel, voltage-gated, type XI, alpha
Synonyms NaN, NSS2, NaT, SNS2
Accession Numbers
Essential gene? Probably non essential (E-score: 0.091) question?
Stock # R6057 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119582829-119654522 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 119594514 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Threonine at position 1293 (N1293T)
Ref Sequence ENSEMBL: ENSMUSP00000149420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]
AlphaFold Q9R053
Predicted Effect probably damaging
Transcript: ENSMUST00000070617
AA Change: N1293T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: N1293T

DomainStartEndE-ValueType
low complexity region 27 43 N/A INTRINSIC
Pfam:Ion_trans 128 409 1.1e-72 PFAM
low complexity region 475 487 N/A INTRINSIC
Pfam:Ion_trans 574 810 4e-57 PFAM
Pfam:Na_trans_assoc 814 1030 4.1e-29 PFAM
Pfam:Ion_trans 1034 1300 5.7e-66 PFAM
Pfam:Ion_trans 1346 1595 3e-58 PFAM
low complexity region 1683 1694 N/A INTRINSIC
low complexity region 1733 1744 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215718
AA Change: N1293T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,156,500 (GRCm39) probably benign Het
Acan A G 7: 78,749,530 (GRCm39) S11G probably null Het
Ankrd13d A C 19: 4,332,256 (GRCm39) V56G probably damaging Het
Arl15 A G 13: 114,104,151 (GRCm39) Y76C probably damaging Het
Aspg G A 12: 112,087,432 (GRCm39) C296Y probably damaging Het
Astl T A 2: 127,187,889 (GRCm39) D101E probably benign Het
Bmpr2 A G 1: 59,881,977 (GRCm39) N202S probably benign Het
Borcs7 T C 19: 46,690,003 (GRCm39) *106Q probably null Het
Brip1 A G 11: 85,955,865 (GRCm39) S883P possibly damaging Het
Cacng2 A T 15: 78,002,991 (GRCm39) L34Q probably damaging Het
Catip A C 1: 74,402,077 (GRCm39) D84A probably damaging Het
Ccdc162 A G 10: 41,510,037 (GRCm39) L856S possibly damaging Het
Ccdc38 A G 10: 93,417,608 (GRCm39) K500E probably damaging Het
Ccser2 T C 14: 36,663,122 (GRCm39) K21E probably damaging Het
Cd93 A T 2: 148,283,439 (GRCm39) Y636N probably damaging Het
Cep128 A T 12: 91,262,998 (GRCm39) N300K possibly damaging Het
Cfap44 A G 16: 44,269,460 (GRCm39) T1155A probably benign Het
Clec16a T C 16: 10,447,951 (GRCm39) L550P probably damaging Het
Csmd3 T C 15: 47,618,787 (GRCm39) Y1867C probably damaging Het
Cul3 A T 1: 80,249,249 (GRCm39) I674N probably damaging Het
Cybb C G X: 9,316,989 (GRCm39) D246H probably benign Het
Cyp2d34 T C 15: 82,500,552 (GRCm39) H429R probably benign Het
Dab2ip T A 2: 35,582,267 (GRCm39) C4* probably null Het
Dcaf1 A G 9: 106,731,446 (GRCm39) E641G probably damaging Het
Dda1 T A 8: 71,927,276 (GRCm39) probably benign Het
Dmgdh C T 13: 93,888,960 (GRCm39) T866I probably benign Het
Ect2l T C 10: 18,037,250 (GRCm39) T383A probably benign Het
Ets2 A G 16: 95,515,416 (GRCm39) N181D probably benign Het
Ezh2 A G 6: 47,529,357 (GRCm39) F222L probably damaging Het
Frem3 T C 8: 81,342,216 (GRCm39) L1503P probably damaging Het
Fsip2 C A 2: 82,809,777 (GRCm39) A2032E probably damaging Het
Gm1818 C T 12: 48,602,346 (GRCm39) noncoding transcript Het
Gm9493 A G 19: 23,597,106 (GRCm39) S1G probably damaging Het
Grin2b A G 6: 135,710,942 (GRCm39) I868T possibly damaging Het
Ift22 A T 5: 136,939,987 (GRCm39) T17S possibly damaging Het
Il4ra T C 7: 125,170,735 (GRCm39) W216R probably damaging Het
Kcnj6 A T 16: 94,633,236 (GRCm39) W274R probably damaging Het
Kctd19 G A 8: 106,123,082 (GRCm39) H111Y probably damaging Het
Kremen2 A G 17: 23,961,679 (GRCm39) V276A probably benign Het
Lig1 C A 7: 13,022,598 (GRCm39) Q143K probably damaging Het
Lrp1 A T 10: 127,403,359 (GRCm39) D2071E probably damaging Het
Macf1 C T 4: 123,404,536 (GRCm39) M475I probably damaging Het
Mbtd1 G A 11: 93,820,485 (GRCm39) A427T probably damaging Het
Myof A G 19: 37,915,429 (GRCm39) probably null Het
Nbeal2 T C 9: 110,470,945 (GRCm39) D308G possibly damaging Het
Ncdn T C 4: 126,638,824 (GRCm39) Q665R probably benign Het
Nkd1 T C 8: 89,316,442 (GRCm39) probably null Het
Nktr G A 9: 121,577,455 (GRCm39) probably benign Het
Npc1l1 A T 11: 6,167,806 (GRCm39) M995K possibly damaging Het
Or10ag59 C A 2: 87,406,363 (GRCm39) R312S probably benign Het
Or11g7 A T 14: 50,691,201 (GRCm39) R231* probably null Het
Or14n1-ps1 T A 7: 86,092,397 (GRCm39) C69* probably null Het
Padi4 T C 4: 140,487,351 (GRCm39) T184A probably damaging Het
Pgm2l1 C T 7: 99,915,881 (GRCm39) P409S probably benign Het
Pgpep1 G A 8: 71,105,101 (GRCm39) T53M probably damaging Het
Pgr T C 9: 8,902,006 (GRCm39) L513P probably damaging Het
Pikfyve T A 1: 65,311,730 (GRCm39) I1989N probably damaging Het
Prrc2a T C 17: 35,371,716 (GRCm39) T1806A probably benign Het
Psd T C 19: 46,311,753 (GRCm39) E309G possibly damaging Het
Qtrt1 C T 9: 21,323,299 (GRCm39) T50I probably damaging Het
Rims2 A C 15: 39,538,416 (GRCm39) T1320P probably damaging Het
Scn8a T C 15: 100,872,548 (GRCm39) F529S possibly damaging Het
Sec14l4 A T 11: 3,985,142 (GRCm39) D25V possibly damaging Het
Sema3a C T 5: 13,615,832 (GRCm39) R419C probably damaging Het
Slc12a1 T C 2: 125,032,133 (GRCm39) Y595H probably damaging Het
Slc25a28 A T 19: 43,655,364 (GRCm39) H170Q possibly damaging Het
Slc26a1 T A 5: 108,821,631 (GRCm39) Q86L probably damaging Het
Slc48a1 T A 15: 97,687,798 (GRCm39) W51R probably damaging Het
Sptlc3 T A 2: 139,423,533 (GRCm39) V309D probably damaging Het
Srcap G A 7: 127,140,528 (GRCm39) S1375N probably damaging Het
Tanc1 C A 2: 59,647,837 (GRCm39) H986Q possibly damaging Het
Tbc1d4 A G 14: 101,727,353 (GRCm39) V486A probably damaging Het
Tceanc2 T C 4: 107,004,776 (GRCm39) D124G probably damaging Het
Tdrd9 A G 12: 111,979,720 (GRCm39) M402V possibly damaging Het
Tmem132d T C 5: 127,861,934 (GRCm39) D729G probably damaging Het
Tmem62 T A 2: 120,807,943 (GRCm39) I55N probably damaging Het
Tnfrsf21 A T 17: 43,350,606 (GRCm39) N257Y possibly damaging Het
Trappc3 T C 4: 126,167,834 (GRCm39) L131P probably damaging Het
Vmn2r25 A T 6: 123,799,900 (GRCm39) M814K possibly damaging Het
Vmn2r87 T C 10: 130,308,226 (GRCm39) I671V probably benign Het
Vwa8 A T 14: 79,320,313 (GRCm39) D1108V probably benign Het
Xrcc4 C G 13: 90,139,198 (GRCm39) A241P possibly damaging Het
Xylt1 T A 7: 117,191,135 (GRCm39) D310E probably benign Het
Zfp27 T G 7: 29,594,444 (GRCm39) H507P possibly damaging Het
Zfp341 C T 2: 154,466,954 (GRCm39) P108S probably benign Het
Zfp641 T C 15: 98,190,816 (GRCm39) N76S probably benign Het
Zfp936 T C 7: 42,839,787 (GRCm39) V418A probably benign Het
Other mutations in Scn11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Scn11a APN 9 119,599,572 (GRCm39) missense probably benign 0.00
IGL00272:Scn11a APN 9 119,645,669 (GRCm39) missense probably damaging 0.98
IGL00332:Scn11a APN 9 119,598,982 (GRCm39) missense probably damaging 1.00
IGL00533:Scn11a APN 9 119,603,447 (GRCm39) missense probably damaging 1.00
IGL00972:Scn11a APN 9 119,623,004 (GRCm39) missense probably benign 0.44
IGL01338:Scn11a APN 9 119,613,227 (GRCm39) splice site probably benign
IGL01534:Scn11a APN 9 119,609,888 (GRCm39) missense probably benign 0.27
IGL01838:Scn11a APN 9 119,587,649 (GRCm39) missense probably damaging 1.00
IGL01991:Scn11a APN 9 119,648,970 (GRCm39) missense probably damaging 0.97
IGL02057:Scn11a APN 9 119,594,536 (GRCm39) missense probably damaging 1.00
IGL02290:Scn11a APN 9 119,603,508 (GRCm39) missense probably damaging 0.97
IGL02454:Scn11a APN 9 119,587,610 (GRCm39) missense probably benign 0.00
IGL02517:Scn11a APN 9 119,621,464 (GRCm39) missense probably damaging 1.00
IGL02567:Scn11a APN 9 119,633,555 (GRCm39) missense probably damaging 0.99
IGL02587:Scn11a APN 9 119,634,750 (GRCm39) missense probably damaging 1.00
IGL03069:Scn11a APN 9 119,619,029 (GRCm39) missense probably benign 0.16
IGL03171:Scn11a APN 9 119,648,913 (GRCm39) missense probably benign 0.00
Kleinie UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
H8441:Scn11a UTSW 9 119,636,976 (GRCm39) missense probably damaging 1.00
PIT4449001:Scn11a UTSW 9 119,599,014 (GRCm39) missense probably damaging 1.00
R0304:Scn11a UTSW 9 119,648,928 (GRCm39) missense probably benign 0.00
R0519:Scn11a UTSW 9 119,619,185 (GRCm39) missense probably damaging 1.00
R0658:Scn11a UTSW 9 119,640,226 (GRCm39) missense probably benign 0.41
R0828:Scn11a UTSW 9 119,584,073 (GRCm39) missense probably benign 0.00
R0893:Scn11a UTSW 9 119,632,396 (GRCm39) splice site probably null
R0932:Scn11a UTSW 9 119,636,876 (GRCm39) missense probably damaging 1.00
R1061:Scn11a UTSW 9 119,624,729 (GRCm39) missense probably damaging 0.98
R1161:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1162:Scn11a UTSW 9 119,634,710 (GRCm39) splice site probably benign
R1310:Scn11a UTSW 9 119,584,123 (GRCm39) nonsense probably null
R1589:Scn11a UTSW 9 119,598,873 (GRCm39) missense probably damaging 1.00
R1681:Scn11a UTSW 9 119,633,478 (GRCm39) missense possibly damaging 0.46
R1781:Scn11a UTSW 9 119,584,148 (GRCm39) missense probably damaging 1.00
R1812:Scn11a UTSW 9 119,609,931 (GRCm39) nonsense probably null
R1901:Scn11a UTSW 9 119,608,102 (GRCm39) nonsense probably null
R1978:Scn11a UTSW 9 119,609,861 (GRCm39) nonsense probably null
R1985:Scn11a UTSW 9 119,583,744 (GRCm39) missense probably benign 0.19
R2022:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2072:Scn11a UTSW 9 119,640,274 (GRCm39) missense possibly damaging 0.88
R2098:Scn11a UTSW 9 119,621,560 (GRCm39) missense possibly damaging 0.67
R2163:Scn11a UTSW 9 119,584,091 (GRCm39) missense probably damaging 1.00
R2250:Scn11a UTSW 9 119,587,668 (GRCm39) missense probably benign 0.01
R2373:Scn11a UTSW 9 119,642,252 (GRCm39) missense probably benign 0.43
R2508:Scn11a UTSW 9 119,594,595 (GRCm39) missense probably damaging 1.00
R3757:Scn11a UTSW 9 119,632,569 (GRCm39) missense probably benign 0.16
R3767:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R3770:Scn11a UTSW 9 119,613,115 (GRCm39) missense probably damaging 1.00
R4089:Scn11a UTSW 9 119,624,719 (GRCm39) splice site probably null
R4092:Scn11a UTSW 9 119,619,036 (GRCm39) missense probably benign 0.03
R4247:Scn11a UTSW 9 119,636,952 (GRCm39) missense probably damaging 1.00
R4279:Scn11a UTSW 9 119,583,428 (GRCm39) missense probably benign 0.25
R4299:Scn11a UTSW 9 119,594,572 (GRCm39) missense probably damaging 0.97
R4403:Scn11a UTSW 9 119,624,733 (GRCm39) missense probably damaging 1.00
R4468:Scn11a UTSW 9 119,584,053 (GRCm39) missense probably damaging 1.00
R4542:Scn11a UTSW 9 119,584,200 (GRCm39) missense probably damaging 1.00
R4644:Scn11a UTSW 9 119,644,269 (GRCm39) splice site probably null
R4739:Scn11a UTSW 9 119,583,627 (GRCm39) missense probably benign 0.39
R4809:Scn11a UTSW 9 119,648,936 (GRCm39) missense probably benign 0.00
R4954:Scn11a UTSW 9 119,587,725 (GRCm39) missense possibly damaging 0.84
R5012:Scn11a UTSW 9 119,609,944 (GRCm39) missense probably benign 0.31
R5044:Scn11a UTSW 9 119,648,897 (GRCm39) missense probably damaging 0.98
R5222:Scn11a UTSW 9 119,644,268 (GRCm39) splice site probably null
R5224:Scn11a UTSW 9 119,583,858 (GRCm39) missense probably damaging 1.00
R5400:Scn11a UTSW 9 119,598,974 (GRCm39) missense probably damaging 0.97
R5555:Scn11a UTSW 9 119,584,304 (GRCm39) missense probably damaging 1.00
R5711:Scn11a UTSW 9 119,618,990 (GRCm39) missense probably damaging 1.00
R5950:Scn11a UTSW 9 119,640,190 (GRCm39) missense probably damaging 1.00
R5984:Scn11a UTSW 9 119,613,082 (GRCm39) missense probably benign
R6104:Scn11a UTSW 9 119,624,744 (GRCm39) missense probably damaging 1.00
R6180:Scn11a UTSW 9 119,583,933 (GRCm39) missense probably benign 0.00
R6892:Scn11a UTSW 9 119,636,035 (GRCm39) missense possibly damaging 0.53
R6908:Scn11a UTSW 9 119,621,492 (GRCm39) missense probably damaging 1.00
R6949:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably benign 0.04
R7112:Scn11a UTSW 9 119,583,875 (GRCm39) missense probably damaging 1.00
R7232:Scn11a UTSW 9 119,588,982 (GRCm39) missense probably damaging 1.00
R7261:Scn11a UTSW 9 119,648,899 (GRCm39) missense probably damaging 0.99
R7265:Scn11a UTSW 9 119,644,331 (GRCm39) missense probably damaging 1.00
R7302:Scn11a UTSW 9 119,636,017 (GRCm39) missense probably benign 0.03
R7391:Scn11a UTSW 9 119,624,783 (GRCm39) missense probably damaging 1.00
R7441:Scn11a UTSW 9 119,587,692 (GRCm39) missense probably benign 0.01
R7479:Scn11a UTSW 9 119,588,941 (GRCm39) missense probably benign 0.38
R7608:Scn11a UTSW 9 119,644,379 (GRCm39) splice site probably null
R7768:Scn11a UTSW 9 119,644,338 (GRCm39) missense probably benign 0.13
R7785:Scn11a UTSW 9 119,645,622 (GRCm39) missense probably benign 0.00
R7794:Scn11a UTSW 9 119,594,580 (GRCm39) missense probably damaging 0.99
R7818:Scn11a UTSW 9 119,613,177 (GRCm39) missense probably damaging 0.97
R7884:Scn11a UTSW 9 119,633,617 (GRCm39) missense probably benign 0.01
R7988:Scn11a UTSW 9 119,594,503 (GRCm39) missense probably damaging 0.97
R8049:Scn11a UTSW 9 119,584,149 (GRCm39) missense probably damaging 1.00
R8127:Scn11a UTSW 9 119,633,578 (GRCm39) missense probably damaging 1.00
R8274:Scn11a UTSW 9 119,632,548 (GRCm39) missense probably benign
R8344:Scn11a UTSW 9 119,611,036 (GRCm39) missense probably benign 0.00
R8346:Scn11a UTSW 9 119,608,047 (GRCm39) missense probably damaging 1.00
R8511:Scn11a UTSW 9 119,618,981 (GRCm39) missense probably damaging 0.99
R8819:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8820:Scn11a UTSW 9 119,645,586 (GRCm39) missense probably benign 0.19
R8837:Scn11a UTSW 9 119,621,410 (GRCm39) missense probably damaging 1.00
R8913:Scn11a UTSW 9 119,623,094 (GRCm39) missense probably damaging 1.00
R8915:Scn11a UTSW 9 119,603,363 (GRCm39) nonsense probably null
R8975:Scn11a UTSW 9 119,587,565 (GRCm39) missense probably damaging 1.00
R9156:Scn11a UTSW 9 119,588,989 (GRCm39) missense possibly damaging 0.75
R9222:Scn11a UTSW 9 119,611,013 (GRCm39) missense probably damaging 0.98
R9355:Scn11a UTSW 9 119,584,160 (GRCm39) missense probably damaging 1.00
R9486:Scn11a UTSW 9 119,624,774 (GRCm39) missense possibly damaging 0.86
R9712:Scn11a UTSW 9 119,619,076 (GRCm39) nonsense probably null
R9766:Scn11a UTSW 9 119,584,181 (GRCm39) missense probably damaging 1.00
Z1088:Scn11a UTSW 9 119,584,308 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,648,886 (GRCm39) missense probably damaging 1.00
Z1177:Scn11a UTSW 9 119,584,064 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTTATCTCTGAGACCACTCTGG -3'
(R):5'- GGGGAAATCCACTCTGGTCTTC -3'

Posted On 2017-07-14