Mutagenetix > Incidental Mutation

Incidental Mutation 'R6057:Xrcc4'

482997

Institutional Source

Beutler Lab

Gene Symbol

Xrcc4

Ensembl Gene

ENSMUSG00000021615

Gene Name

X-ray repair complementing defective repair in Chinese hamster cells 4

Synonyms

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.447) question?

Stock #

R6057 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

89774027-90089608 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 89991079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Proline at position 241 (A241P)

Ref Sequence

ENSEMBL: ENSMUSP00000123934 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022115] [ENSMUST00000159199]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022115
AA Change: A241P

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000022115
Gene: ENSMUSG00000021615
AA Change: A241P

Domain	Start	End	E-Value	Type
Pfam:XRCC4	1	326	1.5e-153	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000159199
AA Change: A241P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123934
Gene: ENSMUSG00000021615
AA Change: A241P

Domain	Start	End	E-Value	Type
Pfam:XRCC4	1	310	2.7e-151	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternative splicing generates several transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants have massive neuronal apoptosis, growth retardation, hypoplastic thymus and die by embryonic day 17.5. Lethality is rescued by Trp53 deficiency, but double knockout mice die from pro-B-cell lymphomas with Myc-Igh translocations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	A	G	6: 52,179,520		probably benign	Het
Acan	A	G	7: 79,099,782	S11G	probably null	Het
Ankrd13d	A	C	19: 4,282,228	V56G	probably damaging	Het
Arl15	A	G	13: 113,967,615	Y76C	probably damaging	Het
Aspg	G	A	12: 112,120,998	C296Y	probably damaging	Het
Astl	T	A	2: 127,345,969	D101E	probably benign	Het
Bmpr2	A	G	1: 59,842,818	N202S	probably benign	Het
Borcs7	T	C	19: 46,701,564	*106Q	probably null	Het
Brip1	A	G	11: 86,065,039	S883P	possibly damaging	Het
Cacng2	A	T	15: 78,118,791	L34Q	probably damaging	Het
Catip	A	C	1: 74,362,918	D84A	probably damaging	Het
Ccdc162	A	G	10: 41,634,041	L856S	possibly damaging	Het
Ccdc38	A	G	10: 93,581,746	K500E	probably damaging	Het
Ccser2	T	C	14: 36,941,165	K21E	probably damaging	Het
Cd93	A	T	2: 148,441,519	Y636N	probably damaging	Het
Cep128	A	T	12: 91,296,224	N300K	possibly damaging	Het
Cfap44	A	G	16: 44,449,097	T1155A	probably benign	Het
Clec16a	T	C	16: 10,630,087	L550P	probably damaging	Het
Csmd3	T	C	15: 47,755,391	Y1867C	probably damaging	Het
Cul3	A	T	1: 80,271,532	I674N	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp2d34	T	C	15: 82,616,351	H429R	probably benign	Het
Dab2ip	T	A	2: 35,692,255	C4*	probably null	Het
Dcaf1	A	G	9: 106,854,247	E641G	probably damaging	Het
Dda1	T	A	8: 71,474,632		probably benign	Het
Dmgdh	C	T	13: 93,752,452	T866I	probably benign	Het
Ect2l	T	C	10: 18,161,502	T383A	probably benign	Het
Ets2	A	G	16: 95,714,372	N181D	probably benign	Het
Ezh2	A	G	6: 47,552,423	F222L	probably damaging	Het
Frem3	T	C	8: 80,615,587	L1503P	probably damaging	Het
Fsip2	C	A	2: 82,979,433	A2032E	probably damaging	Het
Gm1818	C	T	12: 48,555,563		noncoding transcript	Het
Gm9493	A	G	19: 23,619,742	S1G	probably damaging	Het
Grin2b	A	G	6: 135,733,944	I868T	possibly damaging	Het
Ift22	A	T	5: 136,911,133	T17S	possibly damaging	Het
Il4ra	T	C	7: 125,571,563	W216R	probably damaging	Het
Kcnj6	A	T	16: 94,832,377	W274R	probably damaging	Het
Kctd19	G	A	8: 105,396,450	H111Y	probably damaging	Het
Kremen2	A	G	17: 23,742,705	V276A	probably benign	Het
Lig1	C	A	7: 13,288,672	Q143K	probably damaging	Het
Lrp1	A	T	10: 127,567,490	D2071E	probably damaging	Het
Macf1	C	T	4: 123,510,743	M475I	probably damaging	Het
Mbtd1	G	A	11: 93,929,659	A427T	probably damaging	Het
Myof	A	G	19: 37,926,981		probably null	Het
Nbeal2	T	C	9: 110,641,877	D308G	possibly damaging	Het
Ncdn	T	C	4: 126,745,031	Q665R	probably benign	Het
Nkd1	T	C	8: 88,589,814		probably null	Het
Nktr	G	A	9: 121,748,389		probably benign	Het
Npc1l1	A	T	11: 6,217,806	M995K	possibly damaging	Het
Olfr1129	C	A	2: 87,576,019	R312S	probably benign	Het
Olfr300-ps1	T	A	7: 86,443,189	C69*	probably null	Het
Olfr740	A	T	14: 50,453,744	R231*	probably null	Het
Padi4	T	C	4: 140,760,040	T184A	probably damaging	Het
Pgm2l1	C	T	7: 100,266,674	P409S	probably benign	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pgr	T	C	9: 8,902,005	L513P	probably damaging	Het
Pikfyve	T	A	1: 65,272,571	I1989N	probably damaging	Het
Prrc2a	T	C	17: 35,152,740	T1806A	probably benign	Het
Psd	T	C	19: 46,323,314	E309G	possibly damaging	Het
Qtrt1	C	T	9: 21,412,003	T50I	probably damaging	Het
Rims2	A	C	15: 39,675,020	T1320P	probably damaging	Het
Scn11a	T	G	9: 119,765,448	N1293T	probably damaging	Het
Scn8a	T	C	15: 100,974,667	F529S	possibly damaging	Het
Sec14l4	A	T	11: 4,035,142	D25V	possibly damaging	Het
Sema3a	C	T	5: 13,565,865	R419C	probably damaging	Het
Slc12a1	T	C	2: 125,190,213	Y595H	probably damaging	Het
Slc25a28	A	T	19: 43,666,925	H170Q	possibly damaging	Het
Slc26a1	T	A	5: 108,673,765	Q86L	probably damaging	Het
Slc48a1	T	A	15: 97,789,917	W51R	probably damaging	Het
Sptlc3	T	A	2: 139,581,613	V309D	probably damaging	Het
Srcap	G	A	7: 127,541,356	S1375N	probably damaging	Het
Tanc1	C	A	2: 59,817,493	H986Q	possibly damaging	Het
Tbc1d4	A	G	14: 101,489,917	V486A	probably damaging	Het
Tceanc2	T	C	4: 107,147,579	D124G	probably damaging	Het
Tdrd9	A	G	12: 112,013,286	M402V	possibly damaging	Het
Tmem132d	T	C	5: 127,784,870	D729G	probably damaging	Het
Tmem62	T	A	2: 120,977,462	I55N	probably damaging	Het
Tnfrsf21	A	T	17: 43,039,715	N257Y	possibly damaging	Het
Trappc3	T	C	4: 126,274,041	L131P	probably damaging	Het
Vmn2r25	A	T	6: 123,822,941	M814K	possibly damaging	Het
Vmn2r87	T	C	10: 130,472,357	I671V	probably benign	Het
Vwa8	A	T	14: 79,082,873	D1108V	probably benign	Het
Xylt1	T	A	7: 117,591,908	D310E	probably benign	Het
Zfp27	T	G	7: 29,895,019	H507P	possibly damaging	Het
Zfp341	C	T	2: 154,625,034	P108S	probably benign	Het
Zfp641	T	C	15: 98,292,935	N76S	probably benign	Het
Zfp936	T	C	7: 43,190,363	V418A	probably benign	Het

Other mutations in Xrcc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01376:Xrcc4	APN	13	90062050	missense	probably benign	0.00
IGL01486:Xrcc4	APN	13	90062032	nonsense	probably null
R0624:Xrcc4	UTSW	13	89992475	missense	possibly damaging	0.81
R0629:Xrcc4	UTSW	13	90000905	splice site	probably benign
R1801:Xrcc4	UTSW	13	89992579	missense	probably damaging	1.00
R2567:Xrcc4	UTSW	13	90062142	missense	probably damaging	0.99
R3055:Xrcc4	UTSW	13	90062077	missense	probably benign	0.06
R3056:Xrcc4	UTSW	13	90062077	missense	probably benign	0.06
R3941:Xrcc4	UTSW	13	90071633	missense	probably benign	0.01
R4486:Xrcc4	UTSW	13	89992588	missense	possibly damaging	0.79
R4556:Xrcc4	UTSW	13	89992504	missense	probably benign	0.02
R4599:Xrcc4	UTSW	13	90062007	critical splice donor site	probably null
R6262:Xrcc4	UTSW	13	89778787	missense	probably benign	0.00
R6597:Xrcc4	UTSW	13	90000929	missense	probably benign	0.24
R9080:Xrcc4	UTSW	13	90000978	missense	probably damaging	0.99
R9535:Xrcc4	UTSW	13	89940999	missense	probably benign	0.00
Z1176:Xrcc4	UTSW	13	89941042	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCCTTGTTATTACTAACTGCTAC -3'
(R):5'- CACCTCTGTCTGAGCAGAAC -3'

Posted On

2017-07-14