Incidental Mutation 'R6057:Vwa8'
ID483002
Institutional Source Beutler Lab
Gene Symbol Vwa8
Ensembl Gene ENSMUSG00000058997
Gene Namevon Willebrand factor A domain containing 8
Synonyms4932416F07Rik, 1300010F03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6057 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location78849052-79202310 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79082873 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1108 (D1108V)
Ref Sequence ENSEMBL: ENSMUSP00000048925 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040990]
Predicted Effect probably benign
Transcript: ENSMUST00000040990
AA Change: D1108V

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048925
Gene: ENSMUSG00000058997
AA Change: D1108V

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
low complexity region 20 33 N/A INTRINSIC
Pfam:AAA_5 104 260 6.3e-44 PFAM
AAA 438 613 4.69e-2 SMART
AAA 772 904 1.26e-1 SMART
low complexity region 1213 1221 N/A INTRINSIC
low complexity region 1565 1586 N/A INTRINSIC
VWA 1712 1901 2.71e-10 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cul3 A T 1: 80,271,532 I674N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Dmgdh C T 13: 93,752,452 T866I probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Ezh2 A G 6: 47,552,423 F222L probably damaging Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Mbtd1 G A 11: 93,929,659 A427T probably damaging Het
Myof A G 19: 37,926,981 probably null Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Psd T C 19: 46,323,314 E309G possibly damaging Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tbc1d4 A G 14: 101,489,917 V486A probably damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem132d T C 5: 127,784,870 D729G probably damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Vwa8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Vwa8 APN 14 79038195 missense probably damaging 1.00
IGL01087:Vwa8 APN 14 78935229 missense probably benign 0.16
IGL01137:Vwa8 APN 14 79103647 missense probably damaging 1.00
IGL01359:Vwa8 APN 14 79064913 nonsense probably null
IGL01449:Vwa8 APN 14 79182988 nonsense probably null
IGL01604:Vwa8 APN 14 79180804 missense possibly damaging 0.82
IGL01636:Vwa8 APN 14 79198354 missense possibly damaging 0.68
IGL01815:Vwa8 APN 14 79198277 missense possibly damaging 0.92
IGL02024:Vwa8 APN 14 79094284 missense possibly damaging 0.91
IGL02033:Vwa8 APN 14 78984209 missense possibly damaging 0.89
IGL02154:Vwa8 APN 14 78849293 missense possibly damaging 0.53
IGL02286:Vwa8 APN 14 78947273 critical splice donor site probably null
IGL02393:Vwa8 APN 14 79182977 missense probably damaging 1.00
IGL02430:Vwa8 APN 14 78934645 critical splice donor site probably null
IGL02476:Vwa8 APN 14 78925341 missense possibly damaging 0.62
IGL02612:Vwa8 APN 14 79183112 missense probably benign 0.01
IGL02678:Vwa8 APN 14 78984200 missense probably damaging 0.99
IGL02797:Vwa8 APN 14 78925262 missense probably benign 0.29
IGL02806:Vwa8 APN 14 79157088 missense probably benign 0.35
IGL02811:Vwa8 APN 14 78994459 missense probably benign 0.21
IGL02892:Vwa8 APN 14 79103700 splice site probably benign
IGL03024:Vwa8 APN 14 78995098 missense probably benign 0.03
IGL03075:Vwa8 APN 14 78933756 missense probably damaging 0.99
IGL03090:Vwa8 APN 14 78934601 missense possibly damaging 0.92
IGL03124:Vwa8 APN 14 79058815 splice site probably benign
IGL03181:Vwa8 APN 14 79009250 missense probably benign 0.01
IGL03296:Vwa8 APN 14 79183100 missense probably damaging 0.98
IGL03376:Vwa8 APN 14 79183134 splice site probably null
R6812_Vwa8_870 UTSW 14 79197419 missense probably damaging 0.99
IGL03052:Vwa8 UTSW 14 79064921 missense probably benign 0.02
PIT4468001:Vwa8 UTSW 14 79183061 missense probably damaging 1.00
R0049:Vwa8 UTSW 14 79093739 missense probably benign 0.21
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0063:Vwa8 UTSW 14 79164216 splice site probably benign
R0081:Vwa8 UTSW 14 79082782 missense probably benign 0.02
R0305:Vwa8 UTSW 14 79009273 missense probably damaging 1.00
R0433:Vwa8 UTSW 14 79062676 missense probably damaging 1.00
R0514:Vwa8 UTSW 14 78947189 missense probably benign
R0602:Vwa8 UTSW 14 79020620 missense probably benign 0.00
R0615:Vwa8 UTSW 14 78908150 missense probably benign
R0791:Vwa8 UTSW 14 78994576 splice site probably benign
R1028:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1037:Vwa8 UTSW 14 79086654 nonsense probably null
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1404:Vwa8 UTSW 14 79026031 missense probably damaging 1.00
R1412:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1421:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1467:Vwa8 UTSW 14 79103694 nonsense probably null
R1539:Vwa8 UTSW 14 79062562 missense probably benign 0.00
R1556:Vwa8 UTSW 14 79086681 missense probably benign
R1589:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1590:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1591:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1645:Vwa8 UTSW 14 79182987 missense probably damaging 1.00
R1673:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R1688:Vwa8 UTSW 14 79201103 missense possibly damaging 0.72
R1764:Vwa8 UTSW 14 78908195 missense probably damaging 1.00
R1830:Vwa8 UTSW 14 79081136 missense probably benign 0.04
R1926:Vwa8 UTSW 14 79020635 missense probably benign 0.00
R1959:Vwa8 UTSW 14 78982360 missense possibly damaging 0.95
R1971:Vwa8 UTSW 14 78925254 splice site probably benign
R2078:Vwa8 UTSW 14 78908157 missense probably damaging 1.00
R2103:Vwa8 UTSW 14 78908230 missense probably damaging 1.00
R2230:Vwa8 UTSW 14 79092403 critical splice donor site probably null
R2281:Vwa8 UTSW 14 79064996 missense possibly damaging 0.91
R2313:Vwa8 UTSW 14 78912218 missense probably damaging 0.98
R2847:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2848:Vwa8 UTSW 14 78947142 missense probably benign 0.00
R2894:Vwa8 UTSW 14 79038138 missense probably damaging 1.00
R2991:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R3077:Vwa8 UTSW 14 79098342 missense probably benign 0.03
R3405:Vwa8 UTSW 14 79164220 splice site probably benign
R3406:Vwa8 UTSW 14 79164220 splice site probably benign
R3708:Vwa8 UTSW 14 79062696 splice site probably benign
R3779:Vwa8 UTSW 14 79102322 splice site probably benign
R3799:Vwa8 UTSW 14 79064896 missense probably damaging 0.99
R4230:Vwa8 UTSW 14 79082852 missense probably benign 0.00
R4425:Vwa8 UTSW 14 79082806 missense probably benign 0.00
R4478:Vwa8 UTSW 14 78868801 missense probably benign 0.00
R4627:Vwa8 UTSW 14 79103697 critical splice donor site probably null
R4835:Vwa8 UTSW 14 78934613 missense probably benign 0.11
R4868:Vwa8 UTSW 14 79183082 missense probably damaging 1.00
R4988:Vwa8 UTSW 14 79198283 missense probably benign 0.05
R5137:Vwa8 UTSW 14 79064902 missense probably damaging 1.00
R5156:Vwa8 UTSW 14 78984226 missense probably benign 0.00
R5658:Vwa8 UTSW 14 78982398 critical splice donor site probably null
R5841:Vwa8 UTSW 14 78994518 missense probably benign
R6244:Vwa8 UTSW 14 79086662 missense probably benign
R6264:Vwa8 UTSW 14 79086812 missense possibly damaging 0.64
R6290:Vwa8 UTSW 14 79094332 splice site probably null
R6332:Vwa8 UTSW 14 79197464 missense probably benign
R6395:Vwa8 UTSW 14 79093744 missense probably benign 0.02
R6472:Vwa8 UTSW 14 79009170 missense possibly damaging 0.71
R6497:Vwa8 UTSW 14 79096401 missense probably benign 0.00
R6527:Vwa8 UTSW 14 78947213 missense possibly damaging 0.73
R6552:Vwa8 UTSW 14 79198222 missense possibly damaging 0.80
R6812:Vwa8 UTSW 14 79197419 missense probably damaging 0.99
R6994:Vwa8 UTSW 14 78908156 missense possibly damaging 0.90
R7040:Vwa8 UTSW 14 78912205 missense probably damaging 1.00
R7357:Vwa8 UTSW 14 79038201 missense probably null 1.00
R7363:Vwa8 UTSW 14 79018707 missense probably benign 0.05
R7381:Vwa8 UTSW 14 79095685 missense probably benign 0.00
R7406:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7408:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7409:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7410:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7483:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7484:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7491:Vwa8 UTSW 14 79082814 missense probably benign 0.24
R7500:Vwa8 UTSW 14 78925246 intron probably null
R7514:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7582:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7584:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7585:Vwa8 UTSW 14 78982234 critical splice acceptor site probably null
R7647:Vwa8 UTSW 14 78935229 missense probably damaging 0.99
R7685:Vwa8 UTSW 14 79098300 missense probably benign
R7703:Vwa8 UTSW 14 79026073 missense probably damaging 1.00
R7730:Vwa8 UTSW 14 78995149 missense probably benign 0.00
R7775:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7778:Vwa8 UTSW 14 79038147 missense probably benign 0.03
R7824:Vwa8 UTSW 14 79038147 missense probably benign 0.03
Z1088:Vwa8 UTSW 14 78982246 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGCCATGCCAAACGATAAAGTC -3'
(R):5'- CAATCGCATTTTGTGGGGC -3'

Posted On2017-07-14